Molecule Information

General Information of the Molecule (ID: Mol01656)

Name	hsa-miR-485-3p ,Homo sapiens
Synonyms	microRNA 485 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	GUCAUACACGGCUCUCCUCUCU Click to Show/Hide
Ensembl ID	ENSG00000208027
HGNC ID	HGNC:32067
Mature Accession	MIMAT0002176
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Lymphocytic leukemia				[1]
Sensitive Disease	Lymphocytic leukemia [ICD-11: 2B33.2]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	CEM cells	Pleural effusion	Homo sapiens (Human)	N.A.
	CEM/VM-1-5 cells	Lymph	Homo sapiens (Human)	CVCL_1B35
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR-485-3p expression can mediate etoposide sensitivity indirectly by fine-tuning Top2alpha expression through the modification of NF-YB expression. Accordingly, miR-485-3p can be a putative therapeutic target to modulate etoposide resistance in tumor cells.

Etoposide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Lymphocytic leukemia				[1]
Sensitive Disease	Lymphocytic leukemia [ICD-11: 2B33.2]			Disease Info
Sensitive Drug	Etoposide			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	CEM cells	Pleural effusion	Homo sapiens (Human)	N.A.
	CEM/VM-1-5 cells	Lymph	Homo sapiens (Human)	CVCL_1B35
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR-485-3p expression can mediate etoposide sensitivity indirectly by fine-tuning Top2alpha expression through the modification of NF-YB expression. Accordingly, miR-485-3p can be a putative therapeutic target to modulate etoposide resistance in tumor cells.

References

Ref 1	Novel regulation of nuclear factor-YB by miR-485-3p affects the expression of DNA topoisomerase IIAlpha and drug responsiveness. Mol Pharmacol. 2011 Apr;79(4):735-41. doi: 10.1124/mol.110.069633. Epub 2011 Jan 20.