Molecule Information

General Information of the Molecule (ID: Mol01608)

• Name: hsa-miR-126-5p ,Homo sapiens
• Synonyms: microRNA 126
• Molecule Type: Mature miRNA
• Sequence: CAUUAUUACUUUUGGUACGCG
• Ensembl ID: ENSG00000199161
• HGNC ID: HGNC:31508
• Mature Accession: MIMAT0000444

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cytarabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [1]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: Cytarabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: AKTsignaling pathway; Inhibition; hsa04151
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: KG-1 cells; Bone marrow; Homo sapiens (Human); CVCL_0374
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: HK-2 cells; Kidney; Homo sapiens (Human); CVCL_0302
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Transfection of the mimic miR-126-5p into the AML cell line, kG-1, resulted in a decrease in the sensitivity to cytarabin and the expression level of klotho mRNA as well as the elevation in the phosphorylation of Akt. The results of the present study demonstrated that higher expression levels of miR-126-5p/3p in patients with AML resulted in a poorer prognosis. Furthermore, miR-126-5p elevated the phosphorylation of Akt.

References

• Ref 1: Upregulation of microRNA-126-5p is associated with drug resistance to cytarabine and poor prognosis in AML patients. Oncol Rep. 2015 May;33(5):2176-82. doi: 10.3892/or.2015.3839. Epub 2015 Mar 6.