Molecule Information

General Information of the Molecule (ID: Mol01568)

• Name: hsa-miR-129-5p ,Homo sapiens
• Synonyms: microRNA 129-1
• Molecule Type: Mature miRNA
• Sequence: CUUUUUGCGGUCUGGGCUUGC
• Ensembl ID: ENSG00000207705
• HGNC ID: HGNC:31512
• Mature Accession: MIMAT0000242

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; DAPI staining assay
• Mechanism Description: miR129-5p inhibits non-small cell lung cancer cell stemness and chemoresistance through targeting DLk1.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: There is a reciprocal regulation between miR129-5p and SOX4 via the SOX4/EZH2 complex mediated H3k27me3 modification in breast cancer cells. miR129-5p is an important miRNA modulating EMT and MDR in breast cancer cells.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8; Colony formation assay; wound healing; Transwell invasion; Flow cytometry assay
• Mechanism Description: miR-129-5p suppresses Adriamycin resistance in breast cancer by directly targeting SOX2.

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The over-expressed miR-129-5p reduced the chemo-resistance of SGC7901/VCR and SGC7901/ADR cells, while down-regulation of miR-129-5p had an opposite effect. Furthermore, three members of multi-drug resistance (MDR) related ABC transporters (ABCB1, ABCC5 and ABCG1) were found to be direct targets of miR-129-5p using bioinformatics analysis and report gene assays. The present study indicated that hyper-methylation of miR-129-5p CpG island might play important roles in the development of gastric cancer chemo-resistance by targeting MDR related ABC transporters and might be used as a potential therapeutic target in preventing the chemo-resistance of gastric cancer.

Epirubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Epirubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 toxicity assay
• Mechanism Description: NONHSAT101069 was upregulated in BC tissues and promoted epirubicin resistance, migration and invasion of BC cells via regulation of NONHSAT101069/miR-129-5p/Twist1 axis, highlighting its potential as an oncogene and a therapeutic biomarker for BC.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [6]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SW780 cells; Bladder; Homo sapiens (Human); CVCL_1728
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-129-5p inhibits gemcitabine resistance and promotes cell apoptosis of bladder cancer cells by downregulating Wnt5a.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: There is a reciprocal regulation between miR129-5p and SOX4 via the SOX4/EZH2 complex mediated H3k27me3 modification in breast cancer cells. miR129-5p is an important miRNA modulating EMT and MDR in breast cancer cells.

Trastuzumab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Inhibition; hsa04151
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: JIMT-1 cells; Breast; Homo sapiens (Human); CVCL_2077
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR129-5p might inhibit trastuzumab resistance through downregulating rpS6 in Her-2-positive breast cancer cells, thus inactivating the PI3k/Akt/mTOR/ rpS6 pathway.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: There is a reciprocal regulation between miR129-5p and SOX4 via the SOX4/EZH2 complex mediated H3k27me3 modification in breast cancer cells. miR129-5p is an important miRNA modulating EMT and MDR in breast cancer cells.

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The over-expressed miR-129-5p reduced the chemo-resistance of SGC7901/VCR and SGC7901/ADR cells, while down-regulation of miR-129-5p had an opposite effect. Furthermore, three members of multi-drug resistance (MDR) related ABC transporters (ABCB1, ABCC5 and ABCG1) were found to be direct targets of miR-129-5p using bioinformatics analysis and report gene assays. The present study indicated that hyper-methylation of miR-129-5p CpG island might play important roles in the development of gastric cancer chemo-resistance by targeting MDR related ABC transporters and might be used as a potential therapeutic target in preventing the chemo-resistance of gastric cancer.

References

• Ref 1: MiR-129-5p inhibits non-small cell lung cancer cell stemness and chemoresistance through targeting DLK1. Biochem Biophys Res Commun. 2017 Aug 19;490(2):309-316. doi: 10.1016/j.bbrc.2017.06.041. Epub 2017 Jun 12.
• Ref 2: MiR-129-5p is downregulated in breast cancer cells partly due to promoter H3K27m3 modification and regulates epithelial-mesenchymal transition and multi-drug resistance. Eur Rev Med Pharmacol Sci. 2016 Oct;20(20):4257-4265.
• Ref 3: microRNA-129-5p suppresses Adriamycin resistance in breast cancer by targeting SOX2. Arch Biochem Biophys. 2018 Aug 1;651:52-60. doi: 10.1016/j.abb.2018.05.018. Epub 2018 May 23.
• Ref 4: Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget. 2014 Nov 30;5(22):11552-63. doi: 10.18632/oncotarget.2594.
• Ref 5: Long non-coding RNA NONHSAT101069 promotes epirubicin resistance, migration, and invasion of breast cancer cells through NONHSAT101069/miR-129-5p/Twist1 axis. Oncogene. 2019 Nov;38(47):7216-7233. doi: 10.1038/s41388-019-0904-5. Epub 2019 Aug 23.
• Ref 6: miR-129-5p inhibits gemcitabine resistance and promotes cell apoptosis of bladder cancer cells by targeting Wnt5a. Int Urol Nephrol. 2018 Oct;50(10):1811-1819. doi: 10.1007/s11255-018-1959-x. Epub 2018 Aug 16.
• Ref 7: MiR-129-5p Sensitizes the Response of Her-2 Positive Breast Cancer to Trastuzumab by Reducing Rps6. Cell Physiol Biochem. 2017;44(6):2346-2356. doi: 10.1159/000486122. Epub 2017 Dec 15.