Molecule Information

General Information of the Molecule (ID: Mol01567)

• Name: hsa-miR-199a-3p ,Homo sapiens
• Synonyms: microRNA 199a-1
• Molecule Type: Mature miRNA
• Sequence: ACAGUAGUCUGCACAUUGGUUA
• Ensembl ID: ENSG00000207752
• HGNC ID: HGNC:31571
• Mature Accession: MIMAT0000232

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: G-292 cells; Bone; Homo sapiens (Human); CVCL_2909
• In Vitro Model: MNNG/HOS cells; Bone; Homo sapiens (Human); CVCL_0439
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The Ak4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR199a/DDR1 signaling pathway; Regulation; hsa05206
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: IOSE386 cells; Ovary; Homo sapiens (Human); CVCL_E230
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis; Wound healing assay
• Mechanism Description: Suppressing miR199a-3p by promoter methylation contributes to tumor aggressiveness and cisplatin resistance of ovarian cancer through promoting DDR1 expression. Overexpression of miR199a-3p significantly impaired the migratory, invasive, and tumorigenic capabilities of ovarian cancer cells as well as enhanced cisplatin resistance through inhibiting DDR1 expression.

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: G-292 cells; Bone; Homo sapiens (Human); CVCL_2909
• In Vitro Model: MNNG/HOS cells; Bone; Homo sapiens (Human); CVCL_0439
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The Ak4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cholangiocarcinoma [3]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: GBC-SD cells; Gallbladder; Homo sapiens (Human); CVCL_6903
• In Vitro Model: RBE cells; Liver; Homo sapiens (Human); CVCL_4896
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR199a-3p enhances cisplatin sensitivity of cholangiocarcinoma cells by inhibiting mTOR signaling pathway and expression of MDR1. miR199a-3p overexpression could reduce cisplatin induced MDR1 expression by decreasing the synthesis and increasing the degradation of MDR1, thus enhancing the effectiveness of cisplatin in cholangiocarcinoma.

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-231/DDP cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC apoptosis assay
• Mechanism Description: miR199a-3p enhances breast cancer cell sensitivity to cisplatin by downregulating TFAM.

Disease Class: Ovarian cancer [5]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell assay; Flow cytometry assay
• Mechanism Description: miR-199a-3p enhances CDDP sensitivity of ovarian cancer cells through downregulating ITGB8 expression.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MDA-MB-231cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MT-1 cells; Breast; Homo sapiens (Human); CVCL_0441
• In Vitro Model: YPEN-1 cells; Breast; Homo sapiens (Human); CVCL_0587
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Remarkably, miR-199a-3p inhibited both endogenous caveolin-2 activity and exogenous caveolin-2 activity, which was confirmed by a reporter construct bearing the 3'-untranslated region of caveolin-2. However, overexpression of caveolin-2 completely counteracted the enhancement of miR-199a-3p-mediated activities on cell proliferation, survival and sensitivity of tumor cells to anticancer drugs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: G-292 cells; Bone; Homo sapiens (Human); CVCL_2909
• In Vitro Model: MNNG/HOS cells; Bone; Homo sapiens (Human); CVCL_0439
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The Ak4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [7]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: KHOS cells; Bone; Homo sapiens (Human); CVCL_2546
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: CD44 was overexpressed in metastatic and recurrent osteosarcoma as compared with primary tumors. Higher expression of CD44 was found in both patients with shorter survival and patients who exhibited unfavorable response to chemotherapy before surgical resection. Additionally, the 3'-untranslated region of CD44 mRNA was the direct target of microRNA-199a-3p (miR-199a-3p). Overexpression of miR-199a-3p significantly inhibited CD44 expression in osteosarcoma cells. miR-199a-3p is One of the most dramatically decreased miRs in osteosarcoma cells and tumor tissues as compared with normal osteoblast cells. Transfection of miR-199a-3p significantly increased the drug sensitivity through down-regulation of CD44 in osteosarcoma cells. Taken together, these results suggest that the CD44-miR-199a-3p axis plays an important role in the development of metastasis, recurrence, and drug resistance of osteosarcoma. Developing strategies to target CD44 may improve the clinical outcome of osteosarcoma.

Disease Class: Hepatocellular carcinoma [8]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: HLE cells; Liver; Homo sapiens (Human); CVCL_1281
• In Vitro Model: HLF cells; Liver; Homo sapiens (Human); CVCL_2947
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: There is an inverse correlation between the expression of miR-199a-3p and CD44 protein. Transfection of miR-199a-3p into SNU449 cells reduced in vitro invasion and sensitized the cells to doxorubicin. Inhibition of CD44 in CD44+ HCC cell lines using antisense oligonucleotides increased apoptosis, enhanced chemosensitivity, reduced tumorigensis and invasion.

Disease Class: Hepatocellular cancer [9]

• Sensitive Disease: Hepatocellular cancer [ICD-11: 2C12.4]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SNU475 cells; Liver; Homo sapiens (Human); CVCL_0497
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cell invasion assay
• Mechanism Description: The mTOR pathway is activated by multiple extracellular signals, such as growth factors, nutrients, amino acids, hormones, and mitogens leading to the phosphorylation of the translational regulator, phospho-p70S6 kinase, which, in turn, regulates cell proliferation, regulates protein synthesis, and allows progression from the G1 to the S phase of the cell cycle. There is an inverse correlation linking miR-199a-3p and mTOR. miR-199a-3p restoration blocks the G1-S transition of the cell cycle, impairs invasion capability, and sensitizes HCC cells to doxorubicin challenge.

References

• Ref 1: MiR-199a-3p affects the multi-chemoresistance of osteosarcoma through targeting AK4. BMC Cancer. 2018 Jun 4;18(1):631. doi: 10.1186/s12885-018-4460-0.
• Ref 2: Suppressing miR-199a-3p by promoter methylation contributes to tumor aggressiveness and cisplatin resistance of ovarian cancer through promoting DDR1 expression. J Ovarian Res. 2017 Jul 25;10(1):50. doi: 10.1186/s13048-017-0333-4.
• Ref 3: MiR-199a-3p enhances cisplatin sensitivity of cholangiocarcinoma cells by inhibiting mTOR signaling pathway and expression of MDR1. Oncotarget. 2017 May 16;8(20):33621-33630. doi: 10.18632/oncotarget.16834.
• Ref 4: MiR-199a-3p enhances breast cancer cell sensitivity to cisplatin by downregulating TFAM (TFAM). Biomed Pharmacother. 2017 Apr;88:507-514. doi: 10.1016/j.biopha.2017.01.058. Epub 2017 Jan 23.
• Ref 5: miR-199a-3p enhances cisplatin sensitivity of ovarian cancer cells by targeting ITGB8. Oncol Rep. 2018 Apr;39(4):1649-1657. doi: 10.3892/or.2018.6259. Epub 2018 Feb 12.
• Ref 6: MicroRNA miR-199a-3p regulates cell proliferation and survival by targeting caveolin-2. J Cell Sci. 2011 Aug 15;124(Pt 16):2826-36. doi: 10.1242/jcs.077529.
• Ref 7: CD44 is a direct target of miR-199a-3p and contributes to aggressive progression in osteosarcoma. Sci Rep. 2015 Jun 16;5:11365. doi: 10.1038/srep11365.
• Ref 8: miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2010 Dec 3;403(1):120-5. doi: 10.1016/j.bbrc.2010.10.130. Epub 2010 Nov 3.
• Ref 9: MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2010 Jun 15;70(12):5184-93. doi: 10.1158/0008-5472.CAN-10-0145. Epub 2010 May 25.