Molecule Information

General Information of the Molecule (ID: Mol01553)

• Name: hsa-miR-30a-5p ,Homo sapiens
• Synonyms: microRNA 30a
• Molecule Type: Mature miRNA
• Sequence: UGUAAACAUCCUCGACUGGAAG
• Ensembl ID: ENSG00000207827
• HGNC ID: HGNC:31624
• Mature Accession: MIMAT0000087

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: COC1 cells; Ovary; Homo sapiens (Human); CVCL_6891
• In Vitro Model: SkOV3/DDP cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: COC1/DDP cells; Ovary; Homo sapiens (Human); CVCL_6892
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: High expression of miRNA-30a-5p was able to promote cell growth and colony forming ability, and enhance cell migration and invasion.

Disease Class: Melanoma [2]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/P53 signaling pathway; Regulation; hsa04151
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: M8 cells; Skin; Homo sapiens (Human); N.A.
• In Vitro Model: Sk-Mel-19 cells; Skin; Homo sapiens (Human); CVCL_6025
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-30a-5p was over-expressed in cisplatin resistant melanoma cells and could influence the activity of PI3k/AkT and the protein level of P53 by targeting IGF1R gene.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [3]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: Letp cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; WB assay; Colony formation assay; Fow cytometric analysis
• Mechanism Description: Beclin-1-dependent autophagy in SCLC was directly regulated by miR30a-5p. miR30a-5p contributed to chemoresistance of SCLC cells partially in an Beclin-1-dependent manneRNA.

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: ES2 cells; Ovary; Homo sapiens (Human); CVCL_AX39
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR30a/c-5p in turn directly inhibited DNMT1 as well as Snail. Forced expression of miR30a/c-5p or knocking down of DNMT1 and Snail promoted cisplatin susceptibility and partially reversed epithelial-mesenchymal transition (EMT) in CP70 cells.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V-FITC Apoptosis assay; CytoSelect Cell Invasion Assay; Wound healing assay
• Mechanism Description: miR30a-5p overexpression targets the EGFR and insulin-like growth factor receptor-1 (IGF-1R) signaling pathways to overcome the drug resistance. The combination of EGFR and IGF-1R inhibitors treatment could block the PI3k/AkT signaling pathway.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [3]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: Letp cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; WB assay; Colony formation assay; Fow cytometric analysis
• Mechanism Description: Beclin-1-dependent autophagy in SCLC was directly regulated by miR30a-5p. miR30a-5p contributed to chemoresistance of SCLC cells partially in an Beclin-1-dependent manneRNA.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V-FITC Apoptosis assay; CytoSelect Cell Invasion Assay; Wound healing assay
• Mechanism Description: miR30a-5p overexpression targets the EGFR and insulin-like growth factor receptor-1 (IGF-1R) signaling pathways to overcome the drug resistance. The combination of EGFR and IGF-1R inhibitors treatment could block the PI3k/AkT signaling pathway.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [6]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: A549/PR cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460/PR cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR30a-5p increases paclitaxel sensitivity by promoting chemotherapy-induced apoptosis via downregulating BCL-2.

References

• Ref 1: Expression of microRNA-30a-5p in drug-resistant and drug-sensitive ovarian cancer cell lines. Oncol Lett. 2016 Sep;12(3):2065-2070. doi: 10.3892/ol.2016.4831. Epub 2016 Jul 8.
• Ref 2: MiR-30a-5p confers cisplatin resistance by regulating IGF1R expression in melanoma cells. BMC Cancer. 2018 Apr 11;18(1):404. doi: 10.1186/s12885-018-4233-9.
• Ref 3: Intensified Beclin-1 Mediated by Low Expression of Mir-30a-5p Promotes Chemoresistance in Human Small Cell Lung Cancer. Cell Physiol Biochem. 2017;43(3):1126-1139. doi: 10.1159/000481754. Epub 2017 Oct 5.
• Ref 4: A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem. 2017;41(3):973-986. doi: 10.1159/000460618. Epub 2017 Feb 21.
• Ref 5: MiR-30a-5p Overexpression May Overcome EGFR-Inhibitor Resistance through Regulating PI3K/AKT Signaling Pathway in Non-small Cell Lung Cancer Cell Lines. Front Genet. 2016 Nov 15;7:197. doi: 10.3389/fgene.2016.00197. eCollection 2016.
• Ref 6: miR-30a-5p enhances paclitaxel sensitivity in non-small cell lung cancer through targeting BCL-2 expression. J Mol Med (Berl). 2017 Aug;95(8):861-871. doi: 10.1007/s00109-017-1539-z. Epub 2017 May 9.