Molecule Information

General Information of the Molecule (ID: Mol01504)
Name
hsa-mir-202 ,Homo sapiens
Synonyms
microRNA 202
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR202
Gene ID
574448
Location
chr10:133247511-133247620[-]
Sequence
CGCCUCAGAGCCGCCCGCCGUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGGAUCUGGCC
UAAAGAGGUAUAGGGCAUGGGAAAACGGGGCGGUCGGGUCCUCCCCAGCG
    Click to Show/Hide
Ensembl ID
ENSG00000284219
HGNC ID
HGNC:32080
Precursor Accession
MI0003130
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [1]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Bortezomib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation JNk/SAPk signaling pathway Activation hsa05161
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST-1 assay; Annexin V-FLUOS assay
Mechanism Description miR202 contributes to sensitizing MM cells to drug significantly via activing JNk/SAPk signaling pathway. miR202 mimics combined with Bort could inhibit proliferation and induce apoptosis of U266 cells through negative regulating target gene BAFF, which further inhibited the JNk/SAPk signaling pathway.
Disease Class: Multiple myeloma [2]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Bortezomib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
JNk/SAPk signaling pathway Regulation hsa05161
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
MAPK/RAS signaling pathway Inhibition hsa04010
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H441 cells Lung Homo sapiens (Human) CVCL_1561
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The overexpression of miR-202 was found to inhibit the Ras/MAPk pathway by targeting the kRas gene.
Dexamethasone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [2]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Dexamethasone
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
JNk/SAPk signaling pathway Regulation hsa05161
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [4]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
Ku812 cells Bone marrow Homo sapiens (Human) CVCL_0379
KCL-22 cells Bone marrow Homo sapiens (Human) CVCL_2091
EM2 cells Bone Homo sapiens (Human) CVCL_1196
EM3 cells Bone Homo sapiens (Human) CVCL_2033
LAMA 84 cells Bone Homo sapiens (Human) CVCL_0388
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; BrdU assay; Caspase-3 assay
Mechanism Description Overexpression of miR-202 sensitized imatinib resistant CML through the miR-202-mediated glycolysis inhibition by targetting Hk2.
Thalidomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [2]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Thalidomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
JNk/SAPk signaling pathway Regulation hsa05161
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description miR-202 was functioned as a modulator of BAFF expression. miR-202 over-expression sensitized MM cells to bortezomib (Bort) but less to Thalidomide (Thal) and dexamethasone (Dex). miR-202 mimics in combination with Bort inhibited MM cell survival more effectively as compared with Bort treatment alone. Our study also provided experimental evidence that JNk/SAPk signaling pathway was involved in the regulatory effect of miR-202 on drug resistance of MM cells.
References
Ref 1 [miR-202 contributes to sensitizing MM cells to drug significantly via activing JNK/SAPK signaling pathway]. Zhonghua Xue Ye Xue Za Zhi. 2016 Nov 14;37(11):987-992. doi: 10.3760/cma.j.issn.0253-2727.2016.11.012.
Ref 2 Study on the Association Between miRNA-202 Expression and Drug Sensitivity in Multiple Myeloma Cells. Pathol Oncol Res. 2016 Jul;22(3):531-9. doi: 10.1007/s12253-015-0035-4. Epub 2015 Dec 21.
Ref 3 miR-202 Enhances the Anti-Tumor Effect of Cisplatin on Non-Small Cell Lung Cancer by Targeting the Ras/MAPK Pathway. Cell Physiol Biochem. 2018;51(5):2160-2171. doi: 10.1159/000495835. Epub 2018 Dec 6.
Ref 4 Overexpression of miR-202 resensitizes imatinib resistant chronic myeloid leukemia cells through targetting Hexokinase 2. Biosci Rep. 2018 May 8;38(3):BSR20171383. doi: 10.1042/BSR20171383. Print 2018 Jun 29.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.