Molecule Information

General Information of the Molecule (ID: Mol01492)

Name	hsa-mir-196b ,Homo sapiens
Synonyms	microRNA 196b Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR196B
Gene ID	442920
Location	chr7:27169480-27169563[-]
Sequence	ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACG ACACUGCCUUCAUUACUUCAGUUG Click to Show/Hide
Ensembl ID	ENSG00000283745
HGNC ID	HGNC:31790
Precursor Accession	MI0001150
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Etoposide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Hepatocellular carcinoma				[1]
Sensitive Disease	Hepatocellular carcinoma [ICD-11: 2C12.2]			Disease Info
Sensitive Drug	Etoposide			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
	c-Myc signaling pathway		Activation	hsa05230
In Vitro Model	HepG2 cells	Liver	Homo sapiens (Human)	CVCL_0027
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR-196b overexpression decreased IGF2BP1 RNA expression and protein level. The IGF2BP1 down-regulation by either miR-196b or IGF2BP1 siRNA led to an increase in apoptosis and a decrease in cell viability and proliferation in normal culture conditions. However, IGF2BP1 silencing did not modify the chemoresistance induced by hypoxia, probably because it is not the only target of miR-196b involved in the regulation of apoptosis.

Temozolomide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Glioma				[2]
Sensitive Disease	Glioma [ICD-11: 2A00.1]			Disease Info
Sensitive Drug	Temozolomide			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell colony		Inhibition	hsa05200
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	U251 cells	Brain	Homo sapiens (Human)	CVCL_0021
	U87 cells	Brain	Homo sapiens (Human)	CVCL_0022
Experiment for Molecule Alteration	qPCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	Down-regulation of miR-196b increased glioma cell sensitivity to TMZ and E2F1 decreased following transfection with miR-196b inhibitors.

References

Ref 1	miRNA-196b inhibits cell proliferation and induces apoptosis in HepG2 cells by targeting IGF2BP1. Mol Cancer. 2015 Apr 8;14:79. doi: 10.1186/s12943-015-0349-6.
Ref 2	Downregulation of miR-196b Promotes Glioma Cell Sensitivity to Temozolomide Chemotherapy and Radiotherapy. Ann Clin Lab Sci. 2018 Nov;48(6):719-725.