Molecule Information

General Information of the Molecule (ID: Mol01466)

• Name: hsa-mir-363 ,Homo sapiens
• Synonyms: microRNA 363
• Molecule Type: Precursor miRNA
• Gene Name: MIR363
• Gene ID: 574031
• Location: chrX:134169378-134169452[-]
• Sequence:
  UGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUGAGUAUCAUAGGAGAAAAAUUGCACGGU
  AUCCAUCUGUAAACC
• Ensembl ID: ENSG00000284499
• HGNC ID: HGNC:32023
• Precursor Accession: MI0000764

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues.

Disease Class: Hepatocellular carcinoma [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR363/Mcl-1 signaling pathway; Regulation; hsa05206
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Cisplatin-based chemotherapy decreased miR-363 expression in HCC patients. miR-363 expression was also lower in HepG2-R cells than in HepG2 cells, which indicated that the downregulation of miR-363 may be related to cisplatin resistance. overexpression of miR-363 by its mimics can effectively increase the sensitivity of cisplatin-resistant HepG2 cells to cisplatin-induced apoptosis. overexpression of miR-363 could inhibit the expression of Mcl-1 in HepG2-R cells, which implied the inverse correlation between the expression of miR-363 and Mcl-1. More importantly, enforced exogenous Mcl-1 significantly attenuated apoptosis induced by cisplatin. All these results support that Mcl-1 is the target of miR-363 which can enhance sensitivity of human cisplatin-resistant HCC cell cisplatin at least partially.

Disease Class: Epithelial ovarian cancer [3]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Mechanism Description: Down-regulation of miR-363 led to cisplatin resistance in the epithelial ovarian cancer.

Disease Class: Epithelial ovarian cancer [3]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Mechanism Description: Down-regulation of miR-363 led to cisplatin resistance in the epithelial ovarian cancer.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Snail overexpression could significantly attenuate miR-363-suppressed cisplatin resistance of EOC cells, suggesting that miR-363-regulated cisplatin resistance is mediated by snail-induced EMT in EOC cells.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [5]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: NR2F1/AS1/miR363/ABCC1 signaling pathway; Regulation; hsa05206
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell assay
• Mechanism Description: Both NR2F1-AS1 and ABCC1 were up-regulated in oxaliplatin-resistant HCC cells,and miR-363 expression was increased in Huh7/OXA and HepG2/OXA cells transfected with NR2F1-AS1 siRNA compared to empty vector-transfected cells.

References

• Ref 1: miR-363 promotes proliferation and chemo-resistance of human gastric cancer via targeting of FBW7 ubiquitin ligase expression. Oncotarget. 2016 Jun 7;7(23):35284-92. doi: 10.18632/oncotarget.9169.
• Ref 2: Downregulation of miR-363 increases drug resistance in cisplatin-treated HepG2 by dysregulating Mcl-1. Gene. 2015 Nov 1;572(1):116-122. doi: 10.1016/j.gene.2015.07.002. Epub 2015 Jul 2.
• Ref 3: EMT-associated microRNAs and their roles in cancer stemness and drug resistance .Cancer Commun (Lond). 2021 Mar;41(3):199-217. doi: 10.1002/cac2.12138. Epub 2021 Jan 27. 10.1002/cac2.12138
• Ref 4: MiR-363 inhibits cisplatin chemoresistance of epithelial ovarian cancer by regulating snail-induced epithelial-mesenchymal transition. BMB Rep. 2018 Sep;51(9):456-461. doi: 10.5483/BMBRep.2018.51.9.104.
• Ref 5: LncRNA NR2F1-AS1 regulates hepatocellular carcinoma oxaliplatin resistance by targeting ABCC1 via miR-363. J Cell Mol Med. 2018 Jun;22(6):3238-3245. doi: 10.1111/jcmm.13605. Epub 2018 Mar 30.