Molecule Information

General Information of the Molecule (ID: Mol01462)

• Name: hsa-mir-296 ,Homo sapiens
• Synonyms: microRNA 296
• Molecule Type: Precursor miRNA
• Gene Name: MIR296
• Gene ID: 407022
• Location: chr20:58817615-58817694[-]
• Sequence:
  AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCUGUUGUGCCUAAUUCAGAGGGUUGGGUGG
  AGGCUCUCCUGAAGGGCUCU
• Ensembl ID: ENSG00000284040
• HGNC ID: HGNC:31617
• Precursor Accession: MI0000747

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Capecitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Capecitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Response evaluation criteria in solid tumors assay
• Mechanism Description: The patients with decrease in miR-296 at 4 weeks may reflect a more aggressive tumor phenotype with increased metastasis and tumor cell invasiveness. The loss of miR-296 may be one of the mechanisms for primary resistance of colorectal cancer to chemotherapy.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Response evaluation criteria in solid tumors assay
• Mechanism Description: The patients with decrease in miR-296 at 4 weeks may reflect a more aggressive tumor phenotype with increased metastasis and tumor cell invasiveness. The loss of miR-296 may be one of the mechanisms for primary resistance of colorectal cancer to chemotherapy.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax.

References

• Ref 1: Decrease in blood miR-296 predicts chemotherapy resistance and poor clinical outcome in patients receiving systemic chemotherapy for metastatic colon cancer. Int J Colorectal Dis. 2013 Jun;28(6):887. doi: 10.1007/s00384-012-1560-1. Epub 2012 Aug 15.
• Ref 2: The prognostic and chemotherapeutic value of miR-296 in esophageal squamous cell carcinoma. Ann Surg. 2010 Jun;251(6):1056-63. doi: 10.1097/SLA.0b013e3181dd4ea9.