Molecule Information

General Information of the Molecule (ID: Mol01435)

• Name: hsa-mir-125a ,Homo sapiens
• Synonyms: microRNA 125a
• Molecule Type: Precursor miRNA
• Gene Name: MIR125A
• Gene ID: 406910
• Location: chr19:51693254-51693339[+]
• Sequence:
  UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUCCAGGGUCACAGGUGA
  GGUUCUUGGGAGCCUGGCGUCUGGCC
• Ensembl ID: ENSG00000208008
• HGNC ID: HGNC:31505
• Precursor Accession: MI0000469

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [1]

• Resistant Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: CNE-2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6888
• In Vitro Model: TW03 cells; Nasopharynx; Homo sapiens (Human); CVCL_6010
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: In the TW03/DDP cells, the expression levels of miR 125a and miR 125b were upregulated, and this caused downregulation of p53. Ectopic expression of these miRNAs in the TW03 cell model sensitized TW03 to cisplatin by decreasing the protein expression levels of p53, whereas ectopic expression in the antisense oligos of these microRNAs demonstrated the opposite effect. In addition, the present demonstrated that the cisplatin induced expression of miR 125a and miR 125b inhibited cisplatin induced apoptosis in the TW03 cells by decreasing the protein expression levels of p53. Taken together, the present study revealed for the first time, to the best of our knowledge, that induction of the expression of miR 125a and miR 125b by treatment with cisplatin resulted in resistance to the cisplatin drug in the NPC cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [2]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC apoptosis assay
• Mechanism Description: Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [3]

• Resistant Disease: Leukemia [ICD-11: 2B33.6]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: THP-1 cells; Blood; Homo sapiens (Human); CVCL_0006
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Luminescent cell viability assay
• Mechanism Description: miR125a mediated daunorubicin resistance in leukemia cell lines through the decrease of GRk2 and Puma which were proved to be direct targets of miR125a. Overexpression of miR125a induced drug resistance in HL-60, k562, and THP-1cell lines through reducing apoptosis.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [2]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC apoptosis assay
• Mechanism Description: Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [2]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC apoptosis assay
• Mechanism Description: Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [4]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-125a may promote chemo-resistance to gemcitabine in pancreatic cell lines through targeting A20, which may provide novel therapeutic targets or molecular biomarkers for cancer therapy and improve tumor diagnosis or predictions of therapeutic responses.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [5]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: BALB/C nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-125a/b significantly inhibited ALDH1A3 and Mcl1 expression, reduced cell survival, and increased cell apoptosis in HT29-taxol cells. Chemoresistance to paclitaxel is initiated by the downregulation of miR-125a/b expression, which subsequently upregulates ALDH1A3 and Mcl1 expression to promote survival of CSCs.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [2]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC apoptosis assay
• Mechanism Description: Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.

References

• Ref 1: Has miR 125a and 125b are induced by treatment with cisplatin in nasopharyngeal carcinoma and inhibit apoptosis in a p53 dependent manner by targeting p53 mRNA. Mol Med Rep. 2015 Sep;12(3):3569-3574. doi: 10.3892/mmr.2015.3863. Epub 2015 May 27.
• Ref 2: Inhibition of HAX-1 by miR-125a reverses cisplatin resistance in laryngeal cancer stem cells. Oncotarget. 2016 Dec 27;7(52):86446-86456. doi: 10.18632/oncotarget.13424.
• Ref 3: Involvement of miR-125a in resistance to daunorubicin by inhibiting apoptosis in leukemia cell lines. Tumour Biol. 2017 Apr;39(4):1010428317695964. doi: 10.1177/1010428317695964.
• Ref 4: MiR-125a regulates chemo-sensitivity to gemcitabine in human pancreatic cancer cells through targeting A20. Acta Biochim Biophys Sin (Shanghai). 2016 Feb;48(2):202-8. doi: 10.1093/abbs/gmv129. Epub 2016 Jan 11.
• Ref 5: MiR-125a/b regulates the activation of cancer stem cells in paclitaxel-resistant colon cancer. Cancer Invest. 2013 Jan;31(1):17-23. doi: 10.3109/07357907.2012.743557.