Molecule Information

General Information of the Molecule (ID: Mol01431)
Name
hsa-mir-145 ,Homo sapiens
Synonyms
microRNA 145
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR145
Gene ID
406937
Location
chr5:149430646-149430733[+]
Sequence
CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCC
UGGAAAUACUGUUCUUGAGGUCAUGGUU
    Click to Show/Hide
Ensembl ID
ENSG00000276365
HGNC ID
HGNC:31532
Precursor Accession
MI0000461
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [1]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Sensitive Drug Cetuximab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
EGFR/RAS/MAPK signaling pathway Regulation hsa01521
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 Northern blot analysis
Experiment for
Drug Resistance		 MTS assay
Mechanism Description The extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. restoration of miR-143 or miR-145 reduces the aggressiveness of mutant kRAS HCT116 cells. In addition, forced expression of these miRNAs in both mutant and wild-type kRAS colon cancer cells increased their sensitivity to cetuximab by increasing cetuximab-mediated ADCC. Moreover, increased levels of effector cell-mediated caspase-dependent apoptosis were observed for mutant kRAS HCT116 miRNAs-overexpressing cells.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung adenocarcinoma [3]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Epithelial mesenchymal transition signaling pathway Inhibition hsa01521
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assay; Flow cytometry assay; Wound healing assay; Transwell assay; TUNEL assay
Mechanism Description Decreased expression of linc-ROR effectively reversed EMT in docetaxel-resistant LAD cells and sensitized them to chemotherapy. The function of linc-ROR exerted in LAD cells depended on the sponging of miR145, therefore, releasing the miR145 target FSCN1, and thus contributing to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant LAD cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [4]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-kb2 cells Breast Homo sapiens (Human) CVCL_6421
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-145 suppressed MRP1 expression by directly targeting MRP1 3'-untranslated regions. Overexpression of miR-145 sensitized breast cancer cells to doxorubicin in vitro and (+) to doxorubicin chemotherapy in vivo through inducing intracellular doxorubicin accumulation via inhibiting MRP1.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [6]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LS174T cells Colon Homo sapiens (Human) CVCL_1384
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Trypan blue assay; Sulforhodamine B assay
Mechanism Description Inhibition of SNAI2 directly with short hairpin sequence for SNAI2 and miR145 replacement therapy both decreased vimentin expression and increased in vitro 5FU sensitivity.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic adenocarcinoma [7]
Sensitive Disease Pancreatic adenocarcinoma [ICD-11: 2C10.4]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Transwell migration assay
Mechanism Description miRNA-145 increases therapeutic sensibility to gemcitabine treatment of pancreatic adenocarcinoma cells, miR145 negatively regulated p70S6k1 expression at the posttranscriptional level in colon cancer.
Mitomycin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [8]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation p53 signaling pathway Activation hsa04115
In Vitro Model C33A cells Uterus Homo sapiens (Human) CVCL_1094
Experiment for
Molecule Alteration		 RT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 MTT assay
Mechanism Description p53 signalling pathway mediates the cytotoxic effects of chemotherapy, miR-145 augments p53-mediated cytotoxic effects.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [9]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT116/L-OHP cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR145 inhibits drug resistance to L-OHP of HCT116 cells through suppressing the expression of target gene GPR98.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [10]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
MCF-7/ADM cells Breast Homo sapiens (Human) CVCL_0031
A2780/PTX cells Ovary Homo sapiens (Human) CVCL_IJ13
HOEC cells Ovary Homo sapiens (Human) N.A.
SkOV3/PTX cells Ovary Homo sapiens (Human) CVCL_HF69
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-145 modulates the cellular response to anticancer drugs, Down-regulation of miR-145 is correlated with overexpression of Sp1 and Cdk6, Sp1 and Cdk6 are targets of miR-145, miR-145 downregulated P-gp and pRb through inhibition of Sp1 and Cdk6, miR-145 sensitized EOC cells to paclitaxel via Sp1 and Cdk6 inhibition, Overexpression of miR-145 enhanced paclitaxel sensitivity in vivo.
Vemurafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [11]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Vemurafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Established vemurafenib-resistant cell line colo205/V andfound that the miR-145 expression was significantly down-regulated in colo205/V cells compared to normal colo205cells. Moreover, the overexpression of miR-145 could in-crease the sensitivity of colo205/V cells to vemurafenib bothin vitro and in vivo.
References
Ref 1 miR-143 or miR-145 overexpression increases cetuximab-mediated antibody-dependent cellular cytotoxicity in human colon cancer cells. Oncotarget. 2016 Feb 23;7(8):9368-87. doi: 10.18632/oncotarget.7010.
Ref 2 MicroRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer. World J Gastroenterol. 2017 Apr 7;23(13):2337-2345. doi: 10.3748/wjg.v23.i13.2337.
Ref 3 Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway. Oncotarget. 2017 May 16;8(20):33144-33158. doi: 10.18632/oncotarget.16562.
Ref 4 miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
Ref 5 miR-145 sensitizes breast cancer to doxorubicin by targeting multidrug resistance-associated protein-1. Oncotarget. 2016 Sep 13;7(37):59714-59726. doi: 10.18632/oncotarget.10845.
Ref 6 SNAI2 modulates colorectal cancer 5-fluorouracil sensitivity through miR145 repression. Mol Cancer Ther. 2014 Nov;13(11):2713-26. doi: 10.1158/1535-7163.MCT-14-0207. Epub 2014 Sep 23.
Ref 7 MiRNA-145 increases therapeutic sensibility to gemcitabine treatment of pancreatic adenocarcinoma cells. Oncotarget. 2016 Oct 25;7(43):70857-70868. doi: 10.18632/oncotarget.12268.
Ref 8 Glucocorticoid regulation of a novel HPV-E6-p53-miR-145 pathway modulates invasion and therapy resistance of cervical cancer cells. J Pathol. 2012 Oct;228(2):148-57. doi: 10.1002/path.3997. Epub 2012 Apr 18.
Ref 9 [MiR-145 inhibits drug resistance to Oxaliplatin in colorectal cancer cells through regulating G protein coupled receptor 98]. Zhonghua Wei Chang Wai Ke Za Zhi. 2017 May 25;20(5):566-570.
Ref 10 miR-145 sensitizes ovarian cancer cells to paclitaxel by targeting Sp1 and Cdk6. Int J Cancer. 2014 Sep 15;135(6):1286-96. doi: 10.1002/ijc.28774. Epub 2014 Apr 28.
Ref 11 Overexpression of miR-145 increases the sensitivity of vemurafenib in drug-resistant colo205 cell line. Tumour Biol. 2014 Apr;35(4):2983-8. doi: 10.1007/s13277-013-1383-x. Epub 2013 Nov 19.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.