Molecule Information

General Information of the Molecule (ID: Mol01424)
Name
hsa-mir-137 ,Homo sapiens
Synonyms
microRNA 137
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR137
Gene ID
406928
Location
chr1:98046070-98046171[-]
Sequence
GGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUU
AUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCA
    Click to Show/Hide
Ensembl ID
ENSG00000284202
HGNC ID
HGNC:31523
Precursor Accession
MI0000454
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [1]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Bortezomib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model NCI-H929 cells Bone marrow Homo sapiens (Human) CVCL_1600
U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
MM1S cells Peripheral blood Homo sapiens (Human) CVCL_8792
OPM-2 cells Peripheral blood Homo sapiens (Human) CVCL_1625
RPMI-8226 cells Peripheral blood Homo sapiens (Human) CVCL_0014
KMS11 cells Peripheral blood Homo sapiens (Human) CVCL_2989
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Epigenetic silencing of miR137 induces drug resistance and chromosomal instability by targeting AURkA in multiple myeloma.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell colony Activation hsa05200
Cell viability Activation hsa05200
c-Myc signaling pathway Activation hsa05230
In Vitro Model PEO1 cells Ovary Homo sapiens (Human) CVCL_2686
PEO4 cells Ovary Homo sapiens (Human) CVCL_2690
In Vivo Model BALB/c nude mouse xenograft mode Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 SRB assay
Mechanism Description In resistant cells c-Myc enhances the expression of EZH2 by directly suppressing miR-137 that targets EZH2 mRNA, and increased expression of EZH2 activates cellular survival pathways, resulting in the resistance to cisplatin.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [3]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Regulation hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
A549/PTX cells Lung Homo sapiens (Human) CVCL_W218
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Overexpression of miR-137 in A549/PTX and A549/CDDP cells inhibited cell proliferation, migration, induced cell apoptosis, arrest the cell cycle in G1 phase and reversed drug resistance to PTX and CDDP in A549/PTX and A549/CDDP cell lines respectively. NUCkS1 is a direct target of miR-137, and is elevated in human lung cancer tissues, which is inversely correlated with miR-137 expression levels. miR-137 enhances the chemosensitivity of paclitaxel and cisplatin in vivo.
Disease Class: Lung small cell carcinoma [4]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model H446 cells Lung Homo sapiens (Human) CVCL_1562
H446/CDDP cells Lung Homo sapiens (Human) CVCL_RT21
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-137 was closely related to MDR of SCLC, and interference of miR-137 expression may attenuate drug resistant of H446/CDDP cells to cisplatin, partially through kIT expression regulation. kIT might be only one of the downstream molecules of miR-137 that related to SCLC MDR.
Dexamethasone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [5]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Dexamethasone
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Regulation hsa04151
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
RPMI-8226 cells Peripheral blood Homo sapiens (Human) CVCL_0014
In Vivo Model BALB/c nu/nu nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 Real Time RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-137 can improve the dexamethasone sensitivity in multiple myeloma cells by reducing the c-MET expression and further decreasing the AkT phosphorylation via targeting MITF.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Elevated miR-137 expression could sensitize breast cancer cells to chemotherapeutic agents (like Vincristine) through modulating the expression of P-gp by targeting YB-1.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Neuroblastoma [7]
Sensitive Disease Neuroblastoma [ICD-11: 2A00.11]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model UkF-NB3 cells Bone marrow Homo sapiens (Human) CVCL_9904
In Vivo Model Immunodeficient NCr nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Cell titer glo assay assay
Mechanism Description Hypermethylation of the miR-137 promoter and negative regulation of miR-137 by CAR contribute in part to reduced miR-137 expression and increased CAR and MDR1 expression in doxorubicin-resistant neuroblastoma cells.
Disease Class: Colon cancer [7]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model LS174 cells Colon Homo sapiens (Human) CVCL_YJ85
In Vivo Model Immunodeficient NCr nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Cell titer glo assay assay
Mechanism Description Hypermethylation of the miR-137 promoter and negative regulation of miR-137 by CAR contribute in part to reduced miR-137 expression and increased CAR and MDR1 expression in doxorubicin-resistant neuroblastoma cells.
Disease Class: Hepatocellular carcinoma [7]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Immunodeficient NCr nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Cell titer glo assay assay
Mechanism Description Hypermethylation of the miR-137 promoter and negative regulation of miR-137 by CAR contribute in part to reduced miR-137 expression and increased CAR and MDR1 expression in doxorubicin-resistant neuroblastoma cells.
Epirubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [1]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Epirubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model NCI-H929 cells Bone marrow Homo sapiens (Human) CVCL_1600
U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
MM1S cells Peripheral blood Homo sapiens (Human) CVCL_8792
OPM-2 cells Peripheral blood Homo sapiens (Human) CVCL_1625
RPMI-8226 cells Peripheral blood Homo sapiens (Human) CVCL_0014
KMS11 cells Peripheral blood Homo sapiens (Human) CVCL_2989
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Ectopic expression of miR137 strongly reduced the expression of AURkA and p-ATM/Chk2 in MM cells, and increased the expression of p53, and p21, overexpression of miR137 could reduce drug resistance and overcome chromosomal instability of the MM cells via affecting the apoptosis and RNA damage pathways.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [8]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT15 cells Colon Homo sapiens (Human) CVCL_0292
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-137 chemosensitizes colon cancer cells to the chemotherapeutic drug OXA by targeting YBX1, miR137 was involved in repression of YBX1 expression through targeting its 3'-untranslated region. Down-regulation of miR137 conferred OXA resistance in parental cells, while over-expression of miR137 sensitized resistant cells to OXA, which was partly rescued by YBX1 siRNA.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Elevated miR-137 expression could sensitize breast cancer cells to chemotherapeutic agents (like Vincristine) through modulating the expression of P-gp by targeting YB-1.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [3]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Regulation hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
A549/PTX cells Lung Homo sapiens (Human) CVCL_W218
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Overexpression of miR-137 in A549/PTX and A549/CDDP cells inhibited cell proliferation, migration, induced cell apoptosis, arrest the cell cycle in G1 phase and reversed drug resistance to PTX and CDDP in A549/PTX and A549/CDDP cell lines respectively. NUCkS1 is a direct target of miR-137, and is elevated in human lung cancer tissues, which is inversely correlated with miR-137 expression levels. miR-137 enhances the chemosensitivity of paclitaxel and cisplatin in vivo.
Sorafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [9]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Huh7-R cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Wound healing assay; Anoikis assays
Mechanism Description Upregulation of miR137 reverses sorafenib resistance and cancer-initiating cell phenotypes by degrading ANT2 in hepatocellular carcinoma.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Elevated miR-137 expression could sensitize breast cancer cells to chemotherapeutic agents (like Vincristine) through modulating the expression of P-gp by targeting YB-1.
References
Ref 1 Epigenetic silencing of miR-137 induces drug resistance and chromosomal instability by targeting AURKA in multiple myeloma. Leukemia. 2017 May;31(5):1123-1135. doi: 10.1038/leu.2016.325. Epub 2016 Nov 18.
Ref 2 miR-137 mediates the functional link between c-Myc and EZH2 that regulates cisplatin resistance in ovarian cancer. Oncogene. 2019 Jan;38(4):564-580. doi: 10.1038/s41388-018-0459-x. Epub 2018 Aug 30.
Ref 3 MicroRNA-137 inhibits tumor growth and sensitizes chemosensitivity to paclitaxel and cisplatin in lung cancer. Oncotarget. 2016 Apr 12;7(15):20728-42. doi: 10.18632/oncotarget.8011.
Ref 4 MicroRNA-137 down-regulates KIT and inhibits small cell lung cancer cell proliferation. Biomed Pharmacother. 2014 Feb;68(1):7-12. doi: 10.1016/j.biopha.2013.12.002. Epub 2013 Dec 24.
Ref 5 miR-137 Suppresses the Phosphorylation of AKT and Improves the Dexamethasone Sensitivity in Multiple Myeloma Cells Via Targeting MITF. Curr Cancer Drug Targets. 2016;16(9):807-817. doi: 10.2174/1568009616666160203114140.
Ref 6 miR-137 restoration sensitizes multidrug-resistant MCF-7/ADM cells to anticancer agents by targeting YB-1. Acta Biochim Biophys Sin (Shanghai). 2013 Feb;45(2):80-6. doi: 10.1093/abbs/gms099. Epub 2012 Nov 23.
Ref 7 miR-137 regulates the constitutive androstane receptor and modulates doxorubicin sensitivity in parental and doxorubicin-resistant neuroblastoma cells. Oncogene. 2014 Jul 10;33(28):3717-29. doi: 10.1038/onc.2013.330. Epub 2013 Aug 12.
Ref 8 MicroRNA-137 chemosensitizes colon cancer cells to the chemotherapeutic drug oxaliplatin (OXA) by targeting YBX1. Cancer Biomark. 2017;18(1):1-9. doi: 10.3233/CBM-160650.
Ref 9 Upregulation of miR-137 reverses sorafenib resistance and cancer-initiating cell phenotypes by degrading ANT2 in hepatocellular carcinoma. Oncol Rep. 2017 Apr;37(4):2071-2078. doi: 10.3892/or.2017.5498. Epub 2017 Mar 10.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.