Molecule Information

General Information of the Molecule (ID: Mol01419)

• Name: hsa-mir-130a ,Homo sapiens
• Synonyms: microRNA 130a
• Molecule Type: Precursor miRNA
• Gene Name: MIR130A
• Gene ID: 406919
• Location: chr11:57641198-57641286[+]
• Sequence:
  UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGC
  AAUGUUAAAAGGGCAUUGGCCGUGUAGUG
• Ensembl ID: ENSG00000208009
• HGNC ID: HGNC:31514
• Precursor Accession: MI0000448

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: miR-130a and miR-374a mimics decreased the sensitivity of A2780 cells to cisplatin, reversely, their inhibitors could resensitize A2780/DDP cells. Furthermore, overexpression of miR-130a could increase the MDR1 mRNA and P-gp levels in A2780 and A2780/DDP cells, whereas knockdown of miR-130a could inhibit MDR1 gene expression and upregulate the PTEN protein expression. In a conclusion, the deregulation of miR-374a and miR-130a may be involved in the development and regulation of cisplatin resistance in ovarian cancer cells. This role of miR-130a may be achieved by regulating the MDR1 and PTEN gene expression.

Disease Class: Ovarian cancer [2], [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR130a/XIAP signaling pathway; Regulation; hsa05206
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780/DDP cells; Ovary; Homo sapiens (Human); CVCL_D619
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-130a could suppress XIAP expression and sensitize A2780/DDP cells to cisplatin. And finally downstreamtarget validation was proven for the miR-130a, whose downregulation was linked to the translational activation of the M-CSF gene, a knownresistance factor for ovarian cancer.

Disease Class: Hepatocellular carcinoma [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell adhesion; Inhibition; hsa04514
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Oncogenic activation of the Wnt/beta-catenin signaling pathway is common in HCC. Upregulated miR-130a inhibited RUNX3 expression, which resulted in activation of Wnt/beta-catenin signaling and sequent cisplatin resistance.

Disease Class: Ovarian cancer [5]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/PTEN/mTOR signaling pathway; Activation; hsa04151
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: SkOV3/CIS cells; Ovary; Homo sapiens (Human); CVCL_UI88
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-130a, acting as an intermediate, might regulate cisplatin resistance by activating PI3k/Akt/PTEN/mTOR and ABC superfamily drug transporter pathways in ovarian cancer cells.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [6]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9GR cells; Lung; Homo sapiens (Human); CVCL_V337
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Expression of Met has been associated with both primary and acquired resistance to gefitinib, miR-130a expression was negatively correlated with that of Met. Over-expression of miR-130a increased cell apoptosis and inhibited proliferation of NSCLC cells treated with gefitinib, whereas lowering the expression of miR-130a decreased cell apoptosis and promoted cell proliferation after treatment with gefitinib in both gefitinib-sensitive and -resistant NSCLC cell lines.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [7]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: p53 signaling pathway; Regulation; hsa04115
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: BCL-2, MCL-1 and XIAP were the target genes of miR-130a. BCL-2, MCL-1, TCL-1 and XIAP protein levels were significantly higher in patients with drug-sensitive CML cells. Transfected miR-130a mimics significantly decreased the protein expression of BCL-1, MCL-1 and XIAP. Transfected miR-130a significantly increased the CML sensitivity to Gleevec.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [8]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Caspase-3 signaling pathway; Activation; hsa04210
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Glo luminescent cell viability assay
• Mechanism Description: Restoration of miR-130a activated caspase-8 and increased the drug sensitivity in taxane-resistant prostate cancer cells, suggesting that miR-130a may become a potential target for therapy of taxane-resistant CRPC. Since the mechanism of the action of miR-130a was different from that of paclitaxel, a combination therapy of paclitaxel and miR-130a mimic may be effective in treatment of CRPC. Furthermore, it was reported that miR-130a expression was decreased in prostate cancer tissues. It is therefore possible that the restoration of miR-130a could be an effective approach for treating not only taxane-resistant prostate cancer but also prostate cancer with reduced expression of miR-130a.

Disease Class: Ovarian cancer [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CIS cells; Ovary; Homo sapiens (Human); CVCL_1942
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Finally downstreamtarget validation was proven for the miR-130a, whose downregulation was linked to the translational activation of the M-CSF gene, a knownresistance factor for ovarian cancer.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [9]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: A459 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-130a, expressed at low level in lung cancer cell lines, by targeting MET was able to reduce TRAIL resistance in NSCLC cells through the c-Jun mediated downregulation of miR-221 and miR-222.

Investigative Drug(s) 1 drug(s) in total

Platinum

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [10]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Platinum
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: Epithelial ovarian cancer patients; Ovary; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: miR-130a may mediate the generation of platinum resistance in epithelial ovarian cancer through inhibiting PTEN to activate PI3k/AkT signaling pathway and increasing BCL-2 to inhibit tumor cell apoptosis.

References

• Ref 1: MiR-130a and MiR-374a Function as Novel Regulators of Cisplatin Resistance in Human Ovarian Cancer A2780 Cells. PLoS One. 2015 Jun 4;10(6):e0128886. doi: 10.1371/journal.pone.0128886. eCollection 2015.
• Ref 2: Role of microRNAs in drug-resistant ovarian cancer cells. Gynecol Oncol. 2008 Dec;111(3):478-86. doi: 10.1016/j.ygyno.2008.08.017. Epub 2008 Sep 26.
• Ref 3: Downregulation of miR-130a contributes to cisplatin resistance in ovarian cancer cells by targeting X-linked inhibitor of apoptosis (XIAP) directly. Acta Biochim Biophys Sin (Shanghai). 2013 Dec;45(12):995-1001. doi: 10.1093/abbs/gmt113. Epub 2013 Oct 20.
• Ref 4: Upregulated miR-130a increases drug resistance by regulating RUNX3 and Wnt signaling in cisplatin-treated HCC cell. Biochem Biophys Res Commun. 2012 Aug 24;425(2):468-72. doi: 10.1016/j.bbrc.2012.07.127. Epub 2012 Jul 27.
• Ref 5: Altered microRNA expression in cisplatin-resistant ovarian cancer cells and upregulation of miR-130a associated with MDR1/P-glycoprotein-mediated drug resistance. Oncol Rep. 2012 Aug;28(2):592-600. doi: 10.3892/or.2012.1823. Epub 2012 May 18.
• Ref 6: MiR-130a overcomes gefitinib resistance by targeting met in non-small cell lung cancer cell lines. Asian Pac J Cancer Prev. 2014;15(3):1391-6. doi: 10.7314/apjcp.2014.15.3.1391.
• Ref 7: Functional studies of miR-130a on the inhibitory pathways of apoptosis in patients with chronic myeloid leukemia. Cancer Gene Ther. 2015 Dec;22(12):573-80. doi: 10.1038/cgt.2015.50. Epub 2015 Oct 23.
• Ref 8: miR-130a activates apoptotic signaling through activation of caspase-8 in taxane-resistant prostate cancer cells. Prostate. 2015 Oct;75(14):1568-78. doi: 10.1002/pros.23031. Epub 2015 Jun 12.
• Ref 9: miR-130a targets MET and induces TRAIL-sensitivity in NSCLC by downregulating miR-221 and 222. Oncogene. 2012 Feb 2;31(5):634-42. doi: 10.1038/onc.2011.260. Epub 2011 Jun 27.
• Ref 10: [Expression of MiR-130a in Serum Samples of Patients with Epithelial Ovarian Cancer and Its Association with Platinum Resistance]. Sichuan Da Xue Xue Bao Yi Xue Ban. 2016 Jan;47(1):60-3.