Molecule Information

General Information of the Molecule (ID: Mol01418)

• Name: hsa-mir-128a ,Homo sapiens
• Synonyms: microRNA 128-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR128-1
• Gene ID: 406915
• Location: chr2:135665397-135665478[+]
• Sequence:
  UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAAC
  CGGUCUCUUUUUCAGCUGCUUC
• Ensembl ID: ENSG00000207654
• HGNC ID: HGNC:31510
• Precursor Accession: MI0000447

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: MAPK signaling pathway; Activation; hsa04010
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; Colony formation assays
• Mechanism Description: Linc00161 regulated the drug resistance of ovarian cancer by sponging microRNA-128 and modulating MAPk1.

Disease Class: Ovarian cancer [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: PEO14 cells; Ovary; Homo sapiens (Human); CVCL_2687
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-128 resensitized SkOV3/CP cells to cisplatin and reduced the expression of cisplatin-resistant-related proteins ABCC5 and Bmi-1.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [3]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vitro Model: AMC-HN-8 cells; Larynx; Homo sapiens (Human); CVCL_5966
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR128a decreases the expression of BMI1 and suppresses the resistance of laryngeal cancer cells to paclitaxel & cisplatin.

Disease Class: Prostate cancer [4]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-128 binded to the 3'UTR of ZEB1 and inhibited its expression. And ZEB1 (+) PCa chemoresistance and invasion, while miR-128 could reverse that by down-regulated ZEB1. These indicated that miR-128-mediated sensitizing chemoresistance and inhibiting invasion of PCa cells by directly targeting ZEB1.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-128 regulates sensitivity to drugs and apoptosis in breast cancer cells, pro-apoptotic protein bax is negatively post-transcriptionally regulated by miR-128. Bax overexpression could lead to a generalised enhancement of the apoptotic response to death stimuli, miR-128 was significantly associated with a drug fast in breast cancer cells by resisting the activation of the apoptosis pathway.

Disease Class: Breast cancer [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reduction of miR-128 in BT-ICs leads to overexpression of Bmi-1 and ABCC5, two independent targets of miR-128. Ectopic expression of miR-128 decreases cell viability and increases apoptosis and DNA damage in the presence of doxorubicin, hence sensitizes BT-ICs to chemotherapy.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-128 regulates sensitivity to drugs and apoptosis in breast cancer cells, pro-apoptotic protein bax is negatively post-transcriptionally regulated by miR-128. Bax overexpression could lead to a generalised enhancement of the apoptotic response to death stimuli, miR-128 was significantly associated with a drug fast in breast cancer cells by resisting the activation of the apoptosis pathway.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [7]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: c-Met/PI3K/AKT signaling pathway; Inhibition; hsa01521
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR128 reverses the gefitinib resistance of the lung cancer stem cells by inhibiting the c-met/PI3k/AkT pathway. The miR128/c-met pathway enhances the gefitinib sensitivity of the lung cancer stem cells by suppressing the PI3k/AkT pathway.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [8]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• Cell Pathway Regulation: Rapamycin signaling pathway; Inhibition; hsa04211
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR128 can effectively suppress PTX-resistant lung cancer stem cells via inhibition of BMI-1 and MUC1-C, thus downregulating the PI3k/AkT pathway and the rapamycin pathway.

Disease Class: Laryngeal cancer [3]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vitro Model: AMC-HN-8 cells; Larynx; Homo sapiens (Human); CVCL_5966
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR128a decreases the expression of BMI1 and suppresses the resistance of laryngeal cancer cells to paclitaxel & cisplatin.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [9]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Expression of Rap1B is negatively regulated by miR-128 and miR-149. TMZ inhibits Rap1B expression by upregulating miR-128 and miR-149. miR-128 and miR-149 suppress cell proliferation and invasion, and alter cytoskeletal remodeling by affecting Rap1B-associated small GTPase. miR-128 and miR-149 increase the chemosensitivity of TMZ in glioblastoma cells.

References

• Ref 1: Linc00161 regulated the drug resistance of ovarian cancer by sponging microRNA-128 and modulating MAPK1. Mol Carcinog. 2019 Apr;58(4):577-587. doi: 10.1002/mc.22952. Epub 2019 Jan 22.
• Ref 2: Deregulation of miR-128 in ovarian cancer promotes cisplatin resistance. Int J Gynecol Cancer. 2014 Oct;24(8):1381-8. doi: 10.1097/IGC.0000000000000252.
• Ref 3: Overexpressed miR-128a enhances chemoradiotherapy to laryngeal cancer cells and its correlation with BMI1. Future Oncol. 2018 Mar;14(7):611-620. doi: 10.2217/fon-2017-0542. Epub 2017 Nov 30.
• Ref 4: miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1. Jpn J Clin Oncol. 2015 May;45(5):474-82. doi: 10.1093/jjco/hyv027. Epub 2015 Mar 25.
• Ref 5: Downregulation of miRNA-128 sensitises breast cancer cell to chemodrugs by targeting Bax. Cell Biol Int. 2013 Jul;37(7):653-8. doi: 10.1002/cbin.10100. Epub 2013 May 8.
• Ref 6: Reduced miR-128 in breast tumor-initiating cells induces chemotherapeutic resistance via Bmi-1 and ABCC5. Clin Cancer Res. 2011 Nov 15;17(22):7105-15. doi: 10.1158/1078-0432.CCR-11-0071. Epub 2011 Sep 27.
• Ref 7: MiR-128 reverses the gefitinib resistance of the lung cancer stem cells by inhibiting the c-met/PI3K/AKT pathway. Oncotarget. 2016 Nov 8;7(45):73188-73199. doi: 10.18632/oncotarget.12283.
• Ref 8: MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells. Oncotarget. 2017 Nov 30;8(66):110540-110551. doi: 10.18632/oncotarget.22818. eCollection 2017 Dec 15.
• Ref 9: miR-128 and miR-149 enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeletal remodeling in glioblastoma. Oncol Rep. 2014 Sep;32(3):957-64. doi: 10.3892/or.2014.3318. Epub 2014 Jul 10.