Molecule Information

General Information of the Molecule (ID: Mol01409)

• Name: hsa-let-7i ,Homo sapiens
• Synonyms: microRNA let-7i
• Molecule Type: Precursor miRNA
• Gene Name: MIRLET7I
• Gene ID: 406891
• Location: chr12:62603686-62603769[+]
• Sequence:
  CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAUUGCCCGCUGUGGAGAUA
  ACUGCGCAAGCUACUGCCUUGCUA
• Ensembl ID: ENSG00000199179
• HGNC ID: HGNC:31486
• Precursor Accession: MI0000434

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum.

Disease Class: Cervical cancer [1]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum.

Disease Class: Epithelial ovarian cancer [1]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: OVCAR10 cells; Ovary; Homo sapiens (Human); CVCL_4377
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reduced let-7i expression significantly increased the resistance of ovarian and breast cancer cells to the chemotherapy drug, cis-platinum.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometric analysis; TUNEL assay; MTT assay; Colony formation assay
• Mechanism Description: LncRNA XIST overexpression in A549 cells increased their chemosensitivity to cisplatin both in vitro and in vivo by protecting cells from apoptosis and promoting cell proliferation. XIST functioned as competing endogenous RNA to repress let-7i, which controlled its down-stream target BAG-1.

Disease Class: Esophageal carcinoma [3]

• Sensitive Disease: Esophageal carcinoma [ICD-11: 2B70.4]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: HEEpiC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vitro Model: TE10 cells; Esophagus; Homo sapiens (Human); CVCL_1760
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ABCC10, a drug resistance gene, was identified as a functional and direct target gene of miR-let-7g/i. Luciferase reporter assay confirmed that let-7g and let-7i combined directly with 3'UTR of ABCC10, in consequence, inhibiting ABCC10 expression and enhancing cellular sensitivity to drugs.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [4]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometric analysis; CFU assay
• Mechanism Description: miR224 and let-7i regulate the proliferation and chemosensitivity of CML cells probably via targeting ST3GAL IV.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ER-alpha 36 mediated nongenomic estrogen signaling pathway; Activation; hsa04915
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: 184A1 cells; Breast; Homo sapiens (Human); CVCL_3040
• In Vitro Model: HB3396 cells; Breast; Homo sapiens (Human); N.A.
• In Vitro Model: MEGM cells; Breast; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Breast cancer patients with tumors highly expressing ER-alpha36 benefit less from tamoxifen treatment. Both mRNA and protein expression of ER-alpha36 were inhibited by let-7 mimics and enhanced by let-7 inhibitors. Our results suggested a novel regulatory mechanism of let-7 miRNAs on ER-alpha36 mediated nongenomic estrogen signal pathways and Tam resistance.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ER-alpha 36 mediated nongenomic estrogen signaling pathway; Inhibition; hsa04915
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: 184A1 cells; Breast; Homo sapiens (Human); CVCL_3040
• In Vitro Model: HB3396 cells; Breast; Homo sapiens (Human); N.A.
• In Vitro Model: MEGM cells; Breast; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Let-7 miRNAs (b and i) enhanced tamoxifen sensitivity of tamoxifen-resistant breast cancer cells by targeting ER-alpha36 expression.

References

• Ref 1: MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. Cancer Res. 2008 Dec 15;68(24):10307-14. doi: 10.1158/0008-5472.CAN-08-1954.
• Ref 2: LncRNA XIST promotes human lung adenocarcinoma cells to cisplatin resistance via let-7i/BAG-1 axis. Cell Cycle. 2017;16(21):2100-2107. doi: 10.1080/15384101.2017.1361071. Epub 2017 Sep 29.
• Ref 3: BAG3-mediated miRNA let-7g and let-7i inhibit proliferation and enhance apoptosis of human esophageal carcinoma cells by targeting the drug transporter ABCC10. Cancer Lett. 2016 Feb 1;371(1):125-33. doi: 10.1016/j.canlet.2015.11.031. Epub 2015 Dec 3.
• Ref 4: Downregulation of miR-224 and let-7i contribute to cell survival and chemoresistance in chronic myeloid leukemia cells by regulating ST3GAL IV expression. Gene. 2017 Aug 30;626:106-118. doi: 10.1016/j.gene.2017.05.030. Epub 2017 May 13.
• Ref 5: let-7 microRNAs induce tamoxifen sensitivity by downregulation of estrogen receptor Alpha signaling in breast cancer. Mol Med. 2011;17(11-12):1233-41. doi: 10.2119/molmed.2010.00225. Epub 2011 Jul 27.