Molecule Information

General Information of the Molecule (ID: Mol01408)

• Name: hsa-let-7g ,Homo sapiens
• Synonyms: microRNA let-7g
• Molecule Type: Precursor miRNA
• Gene Name: MIRLET7G
• Gene ID: 406890
• Location: chr3:52268278-52268361[-]
• Sequence:
  AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUA
  ACUGUACAGGCCACUGCCUUGCCA
• Ensembl ID: ENSG00000199150
• HGNC ID: HGNC:31485
• Precursor Accession: MI0000433

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal carcinoma [1]

• Sensitive Disease: Esophageal carcinoma [ICD-11: 2B70.4]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: HEEpiC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vitro Model: TE10 cells; Esophagus; Homo sapiens (Human); CVCL_1760
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ABCC10, a drug resistance gene, was identified as a functional and direct target gene of miR-let-7g/i. Luciferase reporter assay confirmed that let-7g and let-7i combined directly with 3'UTR of ABCC10, in consequence, inhibiting ABCC10 expression and enhancing cellular sensitivity to drugs.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cycle; Inhibition; hsa04110
• In Vitro Model: Bel-7402/5-Fu cells; Liver; Homo sapiens (Human); CVCL_5493
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Let-7g microRNA contributed to an increase of 5-Fu-induced cell cycle inhibit in human hepatoma cell and sensitized cells to 5-Fu, leading to increased the effectiveness of the drug in treating hepatoma cancer.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: LOX-IMVI cells; Ovary; Homo sapiens (Human); CVCL_1381
• In Vitro Model: NCI/ADR-RES cells; Ovary; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SRB cytotoxicity assay
• Mechanism Description: IMP-1 is an RNA binding protein that acts by stabilizing the mRNA of a number of target genes. In addition, IMP-1 was shown to protect the mRNA of MDR1 from endonucleolytic attack in an in vitro RNA stability assay. Introducing let-7g into ADR-RES cells expressing both IMP-1 and MDR1 reduced expression of both proteins rendering the cells more sensitive to treatment with either Taxol or vinblastine without affecting the sensitivity of the cells to carboplatin.

Vinblastine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Vinblastine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: LOX-IMVI cells; Ovary; Homo sapiens (Human); CVCL_1381
• In Vitro Model: NCI/ADR-RES cells; Ovary; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SRB cytotoxicity assay
• Mechanism Description: IMP-1 is an RNA binding protein that acts by stabilizing the mRNA of a number of target genes. In addition, IMP-1 was shown to protect the mRNA of MDR1 from endonucleolytic attack in an in vitro RNA stability assay. Introducing let-7g into ADR-RES cells expressing both IMP-1 and MDR1 reduced expression of both proteins rendering the cells more sensitive to treatment with either Taxol or vinblastine without affecting the sensitivity of the cells to carboplatin.

References

• Ref 1: BAG3-mediated miRNA let-7g and let-7i inhibit proliferation and enhance apoptosis of human esophageal carcinoma cells by targeting the drug transporter ABCC10. Cancer Lett. 2016 Feb 1;371(1):125-33. doi: 10.1016/j.canlet.2015.11.031. Epub 2015 Dec 3.
• Ref 2: Let-7 g microRNA sensitizes fluorouracil-resistant human hepatoma cells. Pharmazie. 2014 Apr;69(4):287-92.
• Ref 3: Let-7 modulates acquired resistance of ovarian cancer to Taxanes via IMP-1-mediated stabilization of multidrug resistance 1. Int J Cancer. 2012 Apr 15;130(8):1787-97. doi: 10.1002/ijc.26190. Epub 2011 Aug 16.