Molecule Information

General Information of the Molecule (ID: Mol01399)
Name
hsa-mir-216a ,Homo sapiens
Synonyms
microRNA 216a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR216A
Gene ID
406998
Location
chr2:55988950-55989059[-]
Sequence
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCUCA
CAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUAGCCCUCACGA
    Click to Show/Hide
Ensembl ID
ENSG00000207798
HGNC ID
HGNC:31593
Precursor Accession
MI0000292
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [1]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 16HBE cells Lung Homo sapiens (Human) CVCL_0112
H446 cells Lung Homo sapiens (Human) CVCL_1562
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a.
Disease Class: Ovarian cancer [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell colony Activation hsa05200
Cell proliferation Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-216a increases cisplatin resistance in ovarian cancer cells via downregulating PTEN.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [1]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 16HBE cells Lung Homo sapiens (Human) CVCL_0112
H446 cells Lung Homo sapiens (Human) CVCL_1562
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. HOTTIP functioned as an oncogene in SCLC progression by binding miR216a and abrogating its tumor-suppressive function in this setting. HOTTIP also increased the expression of anti-apoptotic factor BCL-2, a target gene of miR216a, and jointly enhanced chemoresistance of SCLC by regulating BCL-2.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [1]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 16HBE cells Lung Homo sapiens (Human) CVCL_0112
H446 cells Lung Homo sapiens (Human) CVCL_1562
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [3]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
TGF-beta signaling pathway Activation hsa04350
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
BEL-7404 cells Liver Homo sapiens (Human) CVCL_6568
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
SNU449 cells Liver Homo sapiens (Human) CVCL_0454
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
HLE cells Liver Homo sapiens (Human) CVCL_1281
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC.
References
Ref 1 Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR-216a. Cell Death Dis. 2018 Jan 24;9(2):85. doi: 10.1038/s41419-017-0113-5.
Ref 2 STAT3 regulated miR-216a promotes ovarian cancer proliferation and cisplatin resistance. Biosci Rep. 2018 Aug 29;38(4):BSR20180547. doi: 10.1042/BSR20180547. Print 2018 Aug 31.
Ref 3 MicroRNA-216a/217-induced epithelial-mesenchymal transition targets PTEN and SMAD7 to promote drug resistance and recurrence of liver cancer. Hepatology. 2013 Aug;58(2):629-41. doi: 10.1002/hep.26369. Epub 2013 Jun 25.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.