Molecule Information

General Information of the Molecule (ID: Mol01393)

• Name: hsa-mir-205 ,Homo sapiens
• Synonyms: microRNA 205
• Molecule Type: Precursor miRNA
• Gene Name: MIR205
• Gene ID: 406988
• Location: chr1:209432133-209432242[+]
• Sequence:
  AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCA
  UACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA
• Ensembl ID: ENSG00000284485
• HGNC ID: HGNC:31583
• Precursor Accession: MI0000285

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN signaling pathway; Regulation; hsa05235
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-205 promotes the growth of the NSCLC cell lines, miR-205 is inversely correlated with PTEN expression, miR-205 has the ability to promote growth, migration, invasion and chemoresistance of NSCLC cells by targeting PTEN.

Disease Class: Prostate cancer [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vitro Model: 22RV1 cells; Prostate; Homo sapiens (Human); CVCL_1045
• In Vitro Model: VCaP cells; Prostate; Homo sapiens (Human); CVCL_2235
• In Vitro Model: WPE1-NA22 cells; Prostate; Homo sapiens (Human); CVCL_3810
• In Vitro Model: WPE1-NB11 cells; Prostate; Homo sapiens (Human); CVCL_3811
• In Vitro Model: WPE1-NB14 cells; Prostate; Homo sapiens (Human); CVCL_3812
• In Vitro Model: WPE1-NB26 cells; Prostate; Homo sapiens (Human); CVCL_3813
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-205 and miR-31 regulate apoptosis in prostate cancer cells by targeting antiapoptotic proteins Bcl-w and E2F6.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [3]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: ERK signaling pathway; Inhibition; hsa04210
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: VCaP cells; Prostate; Homo sapiens (Human); CVCL_2235
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: UTMD mediated miR 205 transfection increased the expression of caspase 9, cleaved caspase 9, cytochrome c and E cadherin, and decreased the expression of MMP 9 and p ERk,inhibiting PCa cell proliferation, migration and invasion, and promoted apoptosis modulated by cisplatin.

Disease Class: Prostate cancer [4]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vivo Model: SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Lysosome disturbance caused by miR-205-mediated down-regulation of RAB27A and LAMP3 constraints the completion of the autophagic flux by compromising the maturation step and, consequently, interferes with the detoxifying capabilities by which PCa cells may become resistant to CDDP.

Cyclophosphamide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Drug resistance clonogenic assay
• Mechanism Description: miR-205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [2], [6]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vitro Model: 22RV1 cells; Prostate; Homo sapiens (Human); CVCL_1045
• In Vitro Model: VCaP cells; Prostate; Homo sapiens (Human); CVCL_2235
• In Vitro Model: WPE1-NA22 cells; Prostate; Homo sapiens (Human); CVCL_3810
• In Vitro Model: WPE1-NB11 cells; Prostate; Homo sapiens (Human); CVCL_3811
• In Vitro Model: WPE1-NB14 cells; Prostate; Homo sapiens (Human); CVCL_3812
• In Vitro Model: WPE1-NB26 cells; Prostate; Homo sapiens (Human); CVCL_3813
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Docetaxel-resistant cells showed a reduced E-cadherin and an increased vimentin expression accompanied by induced expression of stem cell markers compared with parental cells. Decreased Expression of miR-200c and miR-205 Is Responsible for E-Cadherin Loss in Chemotherapy-Resistant Cells. And miR-205 and miR-31 regulate apoptosis in prostate cancer cells by targeting antiapoptotic proteins Bcl-w and E2F6.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5], [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Colony formation assay; MTT assay; Drug resistance clonogenic assay
• Mechanism Description: The reintroduction of miR-205 is shown to inhibit cell proliferation and clonogenic potential, and increase the sensitivity of MCF-7 and MDA-MB-231 cells to docetaxel. miR-205 also shows a synergistic effect with docetaxel in vivo. And miR-205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Drug resistance clonogenic assay
• Mechanism Description: miR-205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [8]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: Fluorescence-activated cell sorting assay
• Mechanism Description: The activation of the PI3k/Akt survival pathway, so critically important in tumorigenesis, is for the most part driven through phosphorylation of the kinase-inactive member HER3. miR-205, negatively regulating HER3, is able to inhibit breast cancer cell proliferation and improves the response to specific targeted therapies. The reintroduction of miR-205 in SkBr3 cells inhibits their clonogenic potential and increases the responsiveness to tyrosine-kinase inhibitors Gefitinib and Lapatinib, abrogating the HER3-mediated resistance and restoring a potent proapoptotic activity.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [9]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [10]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2R cells; Pancreas; Homo sapiens (Human); CVCL_HA89
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR205 resensitizes GEM-resistant pancreatic cancer cells to GEM and acts as a tumor suppressor miRNA.

Disease Class: Cholangiocarcinoma [11]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HuCCT1 cells; Bile duct; Homo sapiens (Human); CVCL_0324
• In Vitro Model: HuH28 cells; Bile duct; Homo sapiens (Human); CVCL_2955
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-205 could conferred Gem sensitivity to innately Gem-resistant CCA cells.

Lapatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [8]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Lapatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: Fluorescence-activated cell sorting assay
• Mechanism Description: The activation of the PI3k/Akt survival pathway, so critically important in tumorigenesis, is for the most part driven through phosphorylation of the kinase-inactive member HER3. miR-205, negatively regulating HER3, is able to inhibit breast cancer cell proliferation and improves the response to specific targeted therapies. The reintroduction of miR-205 in SkBr3 cells inhibits their clonogenic potential and increases the responsiveness to tyrosine-kinase inhibitors Gefitinib and Lapatinib, abrogating the HER3-mediated resistance and restoring a potent proapoptotic activity.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [12]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: In MDA-MB-231 cells, down-regulated LncRNA-ROR could inhibit the EMT of breast cancer cells and enhance the sensibility of breast cancer cells to tamoxifen by increasing miR205 expression and suppressing the expressions of ZEB1 and ZEB2.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [12]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: In MDA-MB-231 cells, down-regulated LncRNA-ROR could inhibit the EMT of breast cancer cells and enhance the sensibility of breast cancer cells to tamoxifen by increasing miR205 expression and suppressing the expressions of ZEB1 and ZEB2.

References

• Ref 1: miR-205 promotes the growth, metastasis and chemoresistance of NSCLC cells by targeting PTEN. Oncol Rep. 2013 Dec;30(6):2897-902. doi: 10.3892/or.2013.2755. Epub 2013 Sep 30.
• Ref 2: Downregulation of miR-205 and miR-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells. Cell Death Dis. 2010 Dec 9;1(12):e105. doi: 10.1038/cddis.2010.85.
• Ref 3: Ultrasound targeted microbubble destruction mediated miR 205 enhances cisplatin cytotoxicity in prostate cancer cells. Mol Med Rep. 2018 Sep;18(3):3242-3250. doi: 10.3892/mmr.2018.9316. Epub 2018 Jul 24.
• Ref 4: miR-205 impairs the autophagic flux and enhances cisplatin cytotoxicity in castration-resistant prostate cancer cells. Biochem Pharmacol. 2014 Feb 15;87(4):579-97. doi: 10.1016/j.bcp.2013.12.009. Epub 2013 Dec 24.
• Ref 5: miRNA-205 targets VEGFA and FGF2 and regulates resistance to chemotherapeutics in breast cancer. Cell Death Dis. 2016 Jun 30;7(6):e2291. doi: 10.1038/cddis.2016.194.
• Ref 6: Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. Am J Pathol. 2012 Dec;181(6):2188-201. doi: 10.1016/j.ajpath.2012.08.011. Epub 2012 Oct 3.
• Ref 7: MicroRNA-205 increases the sensitivity of docetaxel in breast cancer. Oncol Lett. 2016 Feb;11(2):1105-1109. doi: 10.3892/ol.2015.4030. Epub 2015 Dec 11.
• Ref 8: microRNA-205 regulates HER3 in human breast cancer. Cancer Res. 2009 Mar 15;69(6):2195-200. doi: 10.1158/0008-5472.CAN-08-2920. Epub 2009 Mar 10.
• Ref 9: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 10: Chemosensitization and inhibition of pancreatic cancer stem cell proliferation by overexpression of microRNA-205. Cancer Lett. 2017 Aug 28;402:1-8. doi: 10.1016/j.canlet.2017.05.007. Epub 2017 May 20.
• Ref 11: miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. doi: 10.1371/journal.pone.0077623. eCollection 2013.
• Ref 12: Effects of long noncoding RNA-ROR on tamoxifen resistance of breast cancer cells by regulating microRNA-205. Cancer Chemother Pharmacol. 2017 Feb;79(2):327-337. doi: 10.1007/s00280-016-3208-2. Epub 2017 Jan 6.