Molecule Information

General Information of the Molecule (ID: Mol01387)

• Name: hsa-mir-182 ,Homo sapiens
• Synonyms: microRNA 182
• Molecule Type: Precursor miRNA
• Gene Name: MIR182
• Gene ID: 406958
• Location: chr7:129770383-129770492[-]
• Sequence:
  GAGCUGCUUGCCUCCCCCCGUUUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAACAGG
  AUCCGGUGGUUCUAGACUUGCCAACUAUGGGGCGAGGACUCAGCCGGCAC
• Ensembl ID: ENSG00000207990
• HGNC ID: HGNC:31553
• Precursor Accession: MI0000272

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The expression level of miR-182 in A549 cell line was significantly higher than that in NHBE cell line. Transfection of miR-182 inhibitor induced sensitivity of A549 cells to cisplatin. A549 cells transfected with PDCD4 siRNA became more resistant to cisplatin therapy. We found an increase PDCD4 protein level following the transfection of miR-182 inhibitor using Western blot analysis. In addition, the (+) growth-inhibitory effect by miR-182 inhibitor was weakened after the addition of PDCD4 siRNA.

Disease Class: Hepatocellular carcinoma [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR182/TP53INP1 signaling pathway; Regulation; hsa05206
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-182 levels are significantly increased in HCC patients treated with cisplatin-based chemotherapy. Upregulated miR-182 inhibits TP53INP1 expression, which results in sequent cisplatin resistance.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT-8/5-FU cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3k/AkT pathway. Inhibition of the PI3k/AkT pathway enhanced the chemosensitivity to 5-FU in HCT-8/5-FU and LoVo/5-FU.

Olaparib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Olaparib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vivo Model: CD1 nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: miR-182-mediated down-regulation of BRCA1 impedes DNA repair, and lead to Olaparib resistance.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Inhibition; hsa04140
• Cell Pathway Regulation: MET/PI3K/AKT/mTOR signaling pathway; Activation; hsa04150
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; Transwell assay
• Mechanism Description: Overexpression of miR-182 reduced trastuzumab resistance in trastuzumab-resistant cells due in part to MET/PI3k/AkT/mTOR signaling pathway inactivation.

Clinical Trial Drug(s) 1 drug(s) in total

Oncolytic vaccinia virus

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [6]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oncolytic vaccinia virus
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Virus binding and entry assays
• Mechanism Description: Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer.

Investigative Drug(s) 1 drug(s) in total

Iodine-131

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Thyroid carcinoma [7]

• Resistant Disease: Thyroid carcinoma [ICD-11: 2D10.4]
• Resistant Drug: Iodine-131
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: TPC-1 cells; Thyroid; Homo sapiens (Human); CVCL_6298
• In Vitro Model: FTC-133 cells; Thyroid; Homo sapiens (Human); CVCL_1219
• Experiment for Molecule Alteration: qRT-PCR; Luciferase reporter assay
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: MEG3 expression was decreased while miR-182 expression was increased in 131I-resistant TC cells.

References

• Ref 1: MicroRNA-182 modulates chemosensitivity of human non-small cell lung cancer to cisplatin by targeting PDCD4. Diagn Pathol. 2014 Jul 10;9:143. doi: 10.1186/1746-1596-9-143.
• Ref 2: Upregulated miR-182 increases drug resistance in cisplatin-treated HCC cell by regulating TP53INP1. Gene. 2014 Apr 1;538(2):342-7. doi: 10.1016/j.gene.2013.12.043. Epub 2014 Jan 19.
• Ref 3: Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3K/AKT pathway. Mol Carcinog. 2017 Dec;56(12):2669-2680. doi: 10.1002/mc.22710. Epub 2017 Aug 21.
• Ref 4: miR-182-mediated downregulation of BRCA1 impacts DNA repair and sensitivity to PARP inhibitors. Mol Cell. 2011 Jan 21;41(2):210-20. doi: 10.1016/j.molcel.2010.12.005. Epub 2010 Dec 30.
• Ref 5: miR-182 regulates trastuzumab resistance by targeting MET in breast cancer cells. Cancer Gene Ther. 2019 Feb;26(1-2):1-10. doi: 10.1038/s41417-018-0031-4. Epub 2018 Jun 21.
• Ref 6: Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer. Biochem Biophys Res Commun. 2019 Aug 27;516(3):831-838. doi: 10.1016/j.bbrc.2019.06.125. Epub 2019 Jun 28.
• Ref 7: LncRNA MEG3 enhances (131)I sensitivity in thyroid carcinoma via sponging miR-182. Biomed Pharmacother. 2018 Sep;105:1232-1239. doi: 10.1016/j.biopha.2018.06.087. Epub 2018 Jun 22.