Molecule Information

General Information of the Molecule (ID: Mol01375)

• Name: hsa-mir-30d ,Homo sapiens
• Synonyms: microRNA 30d
• Molecule Type: Precursor miRNA
• Gene Name: MIR30D
• Gene ID: 407033
• Location: chr8:134804876-134804945[-]
• Sequence:
  GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGU
  UUGCUGCUAC
• Ensembl ID: ENSG00000199153
• HGNC ID: HGNC:31628
• Precursor Accession: MI0000255

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [1]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.

Disease Class: Anaplastic thyroid carcinoma [1]

• Sensitive Disease: Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 8305C cells; Thyroid; Homo sapiens (Human); CVCL_1053
• In Vitro Model: SW1736 cells; Thyroid; Homo sapiens (Human); CVCL_3883
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.

Clinical Trial Drug(s) 1 drug(s) in total

Trichostatin A

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon carcinoma [2]

• Resistant Disease: Colon carcinoma [ICD-11: 2B90.2]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Disease Class: Prostate cancer [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Disease Class: Adult acute myeloid leukemia [2]

• Resistant Disease: Adult acute myeloid leukemia [ICD-11: 2A60.1]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Disease Class: Bladder carcinoma [2]

• Resistant Disease: Bladder carcinoma [ICD-11: 2C94.1]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

References

• Ref 1: Regulation of autophagy by miR-30d impacts sensitivity of anaplastic thyroid carcinoma to cisplatin. Biochem Pharmacol. 2014 Feb 15;87(4):562-70. doi: 10.1016/j.bcp.2013.12.004. Epub 2013 Dec 15.
• Ref 2: miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer. Oncogene. 2013 Sep 26;32(39):4694-701. doi: 10.1038/onc.2012.483. Epub 2012 Oct 22.