Molecule Information

General Information of the Molecule (ID: Mol01362)

• Name: hsa-mir-101 ,Homo sapiens
• Synonyms: microRNA 101-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR101-1
• Gene ID: 406893
• Location: chr1:65058434-65058508[-]
• Sequence:
  UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUUCUAAAGGUACAGUACUGUGAU
  AACUGAAGGAUGGCA
• Ensembl ID: ENSG00000199135
• HGNC ID: HGNC:31488
• Precursor Accession: MI0000103

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Bortezomib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [1]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib.

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib.

Disease Class: Colon carcinoma [1]

• Sensitive Disease: Colon carcinoma [ICD-11: 2B90.2]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib.

Disease Class: Hepatocellular cancer [1]

• Sensitive Disease: Hepatocellular cancer [ICD-11: 2C12.4]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: p38/MAPK/AKT signaling pathway; Regulation; hsa04010
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR101 alleviates chemoresistance of gastric cancer cells by targeting ANXA2, ectopic expression of ANXA2 reversed the effect of miR101 on P-gp expression, cell viability and apoptosis. knockdown of ANXA2 increased sensitivity to doxorubicin, 5-FU and DDP by regulating p38MAPk and AkT pathways.

Disease Class: Colon cancer [3]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; AO/EB double staining; Transwell invasion assay
• Mechanism Description: Upregulation of miR101 enhances the cytotoxic effect of anticancer drugs through inhibition of colon cancer cell proliferation. The upregulated expression of miR101 inhibited proliferation and migration, and increased the sensitivity of colon cancer cells to chemotherapy.

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SGC7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry analysis assay
• Mechanism Description: miR-101 inhibits proliferation and promotes DDP-induced apoptosis of SGC7901/DDP cells via negatively mediating the expression of VEGF-C, which facilitate gastric cancer cells sensitivity to Cisplatin.

Disease Class: Epithelial ovarian cancer [5]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; BrdU assay
• Mechanism Description: miR-101 overexpression decreased the expression of EZH2, reduced proliferation and migration of ovarian cancer cells, and resensitized drug-resistant cancer cells to cisplatin-induced cytotoxicity.

Disease Class: Bladder cancer [6]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Enforced expression of miR-101 enhances cisplatin sensitivity in human bladder cancer cells by downregulating the cyclooxygenase-2 pathway.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [7]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCl-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• In Vitro Model: NCI-H520 cells; Lung; Homo sapiens (Human); CVCL_1566
• In Vitro Model: NCI-460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Transwell migration assay; MTS assay
• Mechanism Description: Low miR-101 expression promotes EMT in cisplatin-resistant NSCLC cells. ROCk2 was the direct target of miR-101 and that ROCk2 overexpression reversed miR-101-mediatedEMT and cisplatin resistance in NSCLC cells. ROCk2 protein levels were inversely correlated with miR-101 levels in NSCLC tissue samples and that low miR-101 expression was correlated with poor survival time.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [8]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-101 was downregulated in HCC cell lines, while its overexpression (+) the sensitivity of HepG2 cells to the chemotherapeutic agent DOX by facilitating apoptosis. Of note, Mcl-1 was confirmed as a functional target of miR-101 in HCC, demonstrating that miR-101 may enhance the sensitivity of cancer cells by downregulating Mcl-1 expression.

Disease Class: Osteosarcoma [9]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: Quantitative GFP-LC3 analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miR-101 not only decreases the formation of autophagic vesicles but also reduces the expression of LC-3II and Atg 4. This part of the study shows that miR-101 blocks chemotherapy-induced autophagy in OS cells. The sensitivity of OS cells to chemotherapy is increased by miR-101 blocked autophagy. miR-101 blocked the chemotherapy induced autophagy, and the blocked autophagy by miR-101 enhances the sensitivity of the OS cell line U-2 in vitro.

Disease Class: Hepatocellular carcinoma [10]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-101-mediated EZH2 silencing sensitized hepatoblastoma cells to 5-FU- and doxorubicin-induced apoptosis, whereas antagomiR-mediated downregulation of endogenous miR-101 reversed the pro-apoptotic effect.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [3]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; AO/EB double staining; Transwell invasion assay
• Mechanism Description: Upregulation of miR101 enhances the cytotoxic effect of anticancer drugs through inhibition of colon cancer cell proliferation. The upregulated expression of miR101 inhibited proliferation and migration, and increased the sensitivity of colon cancer cells to chemotherapy.

Disease Class: Hepatocellular carcinoma [10]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-101-mediated EZH2 silencing sensitized hepatoblastoma cells to 5-FU- and doxorubicin-induced apoptosis, whereas antagomiR-mediated downregulation of endogenous miR-101 reversed the pro-apoptotic effect.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [11]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Annexin V apoptosis assay; Caspase-3 activity assay
• Mechanism Description: microRNA-101 silences RNA-Pkcs and sensitizes pancreatic cancer cells to gemcitabine. AntagomiR101 expression causes RNA-Pkcs upregulation and gemcitabine resistance. miR101 expression inhibits Akt activation in PANC-1 cells.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [12]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expressiom; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; TUNEL assay; Flow cytometry assay
• Mechanism Description: The endogenous protein level of GSk3beta and MGMT was significantly suppressed by combination of MALAT1 knockdown and miR-101 overexpression and the promoter methylation of MGMT was largely promoted by the combination of MALAT1 knockdown and miR-101 overexpression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [13]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: U251-MG cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay
• Mechanism Description: microRNA-101 reverses temozolomide resistance by inhibition of GSk3beta in glioblastoma.

Disease Class: Glioblastoma [12]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; TUNEL assay; Flow cytometry assay
• Mechanism Description: The endogenous protein level of GSk3beta and MGMT was significantly suppressed by combination of MALAT1 knockdown and miR-101 overexpression and the promoter methylation of MGMT was largely promoted by the combination of MALAT1 knockdown and miR-101 overexpression.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: p38/MAPK/AKT signaling pathway; Regulation; hsa04010
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR101 alleviates chemoresistance of gastric cancer cells by targeting ANXA2, ectopic expression of ANXA2 reversed the effect of miR101 on P-gp expression, cell viability and apoptosis. knockdown of ANXA2 increased sensitivity to doxorubicin, 5-FU and DDP by regulating p38MAPk and AkT pathways.

References

• Ref 1: MicroRNA-101 Suppresses Tumor Cell Proliferation by Acting as an Endogenous Proteasome Inhibitor via Targeting the Proteasome Assembly Factor POMP. Mol Cell. 2015 Jul 16;59(2):243-57. doi: 10.1016/j.molcel.2015.05.036. Epub 2015 Jul 2.
• Ref 2: miR-101 alleviates chemoresistance of gastric cancer cells by targeting ANXA2. Biomed Pharmacother. 2017 Aug;92:1030-1037. doi: 10.1016/j.biopha.2017.06.011. Epub 2017 Jun 10.
• Ref 3: Upregulation of miR-101 enhances the cytotoxic effect of anticancer drugs through inhibition of colon cancer cell proliferation. Oncol Rep. 2017 Jul;38(1):100-108. doi: 10.3892/or.2017.5666. Epub 2017 May 24.
• Ref 4: MicroRNA-101 induces apoptosis in cisplatin-resistant gastric cancer cells by targeting VEGF-C. Mol Med Rep. 2016 Jan;13(1):572-8. doi: 10.3892/mmr.2015.4560. Epub 2015 Nov 12.
• Ref 5: miR-101 regulates expression of EZH2 and contributes to progression of and cisplatin resistance in epithelial ovarian cancer. Tumour Biol. 2014 Dec;35(12):12619-26. doi: 10.1007/s13277-014-2585-6. Epub 2014 Sep 27.
• Ref 6: Enforced expression of miR-101 enhances cisplatin sensitivity in human bladder cancer cells by modulating the cyclooxygenase-2 pathway. Mol Med Rep. 2014 Oct;10(4):2203-9. doi: 10.3892/mmr.2014.2455. Epub 2014 Aug 6.
• Ref 7: Downregulation of miR-101 contributes to epithelial-mesenchymal transition in cisplatin resistance of NSCLC cells by targeting ROCK2. Oncotarget. 2016 Jun 21;7(25):37524-37535. doi: 10.18632/oncotarget.6852.
• Ref 8: MicroRNA-101 sensitizes hepatocellular carcinoma cells to doxorubicin-induced apoptosis via targeting Mcl-1. Mol Med Rep. 2016 Feb;13(2):1923-9. doi: 10.3892/mmr.2015.4727. Epub 2015 Dec 28.
• Ref 9: Blocked autophagy by miR-101 enhances osteosarcoma cell chemosensitivity in vitro. ScientificWorldJournal. 2014;2014:794756. doi: 10.1155/2014/794756. Epub 2014 Jun 9.
• Ref 10: MicroRNA-101 inhibits human hepatocellular carcinoma progression through EZH2 downregulation and increased cytostatic drug sensitivity. J Hepatol. 2014 Mar;60(3):590-8. doi: 10.1016/j.jhep.2013.10.028. Epub 2013 Nov 6.
• Ref 11: micorRNA-101 silences DNA-PKcs and sensitizes pancreatic cancer cells to gemcitabine. Biochem Biophys Res Commun. 2017 Jan 29;483(1):725-731. doi: 10.1016/j.bbrc.2016.12.074. Epub 2016 Dec 14.
• Ref 12: Long noncoding RNA MALAT1 knockdown reverses chemoresistance to temozolomide via promoting microRNA-101 in glioblastoma. Cancer Med. 2018 Apr;7(4):1404-1415. doi: 10.1002/cam4.1384. Epub 2018 Feb 26.
• Ref 13: MicroRNA-101 reverses temozolomide resistance by inhibition of GSK3Beta in glioblastoma. Oncotarget. 2016 Nov 29;7(48):79584-79595. doi: 10.18632/oncotarget.12861.