Molecule Information

General Information of the Molecule (ID: Mol01332)

• Name: hsa-let-7e ,Homo sapiens
• Synonyms: microRNA let-7e
• Molecule Type: Precursor miRNA
• Gene Name: MIRLET7E
• Gene ID: 406887
• Location: chr19:51692786-51692864[+]
• Sequence:
  CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCACUAUACGG
  CCUCCUAGCUUUCCCCAGG
• Ensembl ID: ENSG00000198972
• HGNC ID: HGNC:31482
• Precursor Accession: MI0000066

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [1]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: ES2 cells; Ovary; Homo sapiens (Human); CVCL_AX39
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of let-7e by transfection of agomir could resensitize A2780/CP and reduce the expression of cisplatin-resistant-related proteins enhancer of zeste 2 (EZH2) and cyclin D1 (CCND1), whereas let-7e inhibitors increased resistance to cisplatin in parental A2780 cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [2]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: ES2 cells; Ovary; Homo sapiens (Human); CVCL_AX39
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Colony-formation assay
• Mechanism Description: Let-7e sensitizes epithelial ovarian cancer to cisplatin through repressing RNA double strand break repair In EOC, low let-7e leads to activation of BRCA1 and Rad51 expression and subsequent enhancement of DSB repair, which in turn results in cisplatin-resistance.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [4]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1.

References

• Ref 1: Deregulation of let-7e in epithelial ovarian cancer promotes the development of resistance to cisplatin. Oncogenesis. 2013 Oct 7;2(10):e75. doi: 10.1038/oncsis.2013.39.
• Ref 2: Let-7e sensitizes epithelial ovarian cancer to cisplatin through repressing DNA double strand break repair. J Ovarian Res. 2017 Apr 4;10(1):24. doi: 10.1186/s13048-017-0321-8.
• Ref 3: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 4: Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.