Molecule Information
General Information of the Molecule (ID: Mol01788)
| Name |
piR-hsa-36712
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Piwi-interacting RNA
|
||||
| Sequence |
AAAAAGAAAGAAATGAATGCTTGGGACCAGAAGT
Click to Show/Hide
|
||||
| piRBase ID | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| In Vivo Model | Mouse xenograft models | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
