General Information of the Molecule (ID: Mol01788)
Name
piR-hsa-36712 ,Homo sapiens
Molecule Type
Piwi-interacting RNA
Sequence
AAAAAGAAAGAAATGAATGCTTGGGACCAGAAGT
    Click to Show/Hide
piRBase ID
piR-hsa-36712
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
In Vivo Model Mouse xenograft models Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA.
References
Ref 1 PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. Mol Cancer. 2019 Jan 12;18(1):9. doi: 10.1186/s12943-019-0940-3.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.