Molecule Information

General Information of the Molecule (ID: Mol01787)

• Name: piR-hsa-39980 ,Homo sapiens
• Molecule Type: Piwi-interacting RNA
• Sequence: AAGAACATATGTGGCCACATTACC
• piRBase ID: piR-hsa-39980

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [1]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.11]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell metastasis; Activation; hsa05205
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: IMR-32 cells; Abdomen; Homo sapiens (Human); CVCL_0346
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: piR-39980 is an oncogenic piRNA overexpressed in NB cells which induces the cancer cell growth, enhance metastasis, and inhibit the cellular senescence by targeting JAk3 as well as desensitizes the chemotherapeutic drug. And piR-39980 was found to desensitize the effect of doxorubicin and inhibit drug-induced apoptosis.

References

• Ref 1: PIWI-interacting RNA 39980 promotes tumor progression and reduces drug sensitivity in neuroblastoma cells. J Cell Physiol. 2020 Mar;235(3):2286-2299. doi: 10.1002/jcp.29136. Epub 2019 Sep 3.