Molecule Information

General Information of the Molecule (ID: Mol01772)
Name
hsa-miR-487b-5p ,Homo sapiens
Synonyms
microRNA 487b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GUGGUUAUCCCUGUCCUGUUCG
    Click to Show/Hide
Ensembl ID
ENSG00000207754
HGNC ID
HGNC:32533
Mature Accession
MIMAT0026614
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [1]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Resistant Drug Temozolomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-487b-5p regulates temozolomide resistance of lung cancer cells through lamp2-medicated autophagy.
References
Ref 1 miR-487b-5p Regulates Temozolomide Resistance of Lung Cancer Cells Through LAMP2-Medicated Autophagy. DNA Cell Biol. 2016 Aug;35(8):385-92. doi: 10.1089/dna.2016.3259. Epub 2016 Apr 20.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.