General Information of the Molecule (ID: Mol01771)
Name
hsa-miR-153-5p ,Homo sapiens
Synonyms
microRNA 153-2
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCAUUUUUGUGAUGUUGCAGCU
    Click to Show/Hide
Ensembl ID
ENSG00000207960
HGNC ID
HGNC:31540
Mature Accession
MIMAT0026480
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [1]
Resistant Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model THP-1 cells Blood Homo sapiens (Human) CVCL_0006
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description CircPAN3 mediates drug resistance in acute myeloid leukemia through the miR-153-5p/miR-183-5p-XIAP axis.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [1]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model THP-1 cells Blood Homo sapiens (Human) CVCL_0006
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description CircPAN3 mediates drug resistance in acute myeloid leukemia through the miR-153-5p/miR-183-5p-XIAP axis.
References
Ref 1 CircPAN3 mediates drug resistance in acute myeloid leukemia through the miR-153-5p/miR-183-5p-XIAP axis. Exp Hematol. 2019 Feb;70:42-54.e3. doi: 10.1016/j.exphem.2018.10.011. Epub 2018 Nov 3.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.