Molecule Information

General Information of the Molecule (ID: Mol01766)

• Name: hsa-miR-3646 ,Homo sapiens
• Synonyms: microRNA 3646
• Molecule Type: Mature miRNA
• Sequence: AAAAUGAAAUGAGCCCAGCCCA
• Ensembl ID: ENSG00000266151
• HGNC ID: HGNC:38935
• Mature Accession: MIMAT0018065

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: GSK-3beta/Beta-catenin signaling pathway; Regulation; hsa04550
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-3646 contributes to drug resistance of breast cancer cells to Doc at least in part through activation of GSk-3beta/beta-catenin pathway by suppressing expression of GSk-3beta.

References

• Ref 1: MicroRNA-3646 Contributes to Docetaxel Resistance in Human Breast Cancer Cells by GSK-3Beta/Beta-Catenin Signaling Pathway. PLoS One. 2016 Apr 5;11(4):e0153194. doi: 10.1371/journal.pone.0153194. eCollection 2016.