Molecule Information

General Information of the Molecule (ID: Mol01760)

• Name: hsa-miR-3127-5p ,Homo sapiens
• Synonyms: microRNA 3127
• Molecule Type: Mature miRNA
• Sequence: AUCAGGGCUUGUGGAAUGGGAAG
• Ensembl ID: ENSG00000264157
• HGNC ID: HGNC:38269
• Mature Accession: MIMAT0014990

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Dasatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Dasatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Abl/RAS/ERK signaling pathway; Activation; hsa04010
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Reduced miR-3127-5p expression promotes NSCLC proliferation/invasion and contributes to dasatinib sensitivity via the c-Abl/Ras/ERk pathway.

References

• Ref 1: Reduced miR-3127-5p expression promotes NSCLC proliferation/invasion and contributes to dasatinib sensitivity via the c-Abl/Ras/ERK pathway. Sci Rep. 2014 Oct 6;4:6527. doi: 10.1038/srep06527.