Molecule Information
General Information of the Molecule (ID: Mol01752)
Name |
hsa-miR-1294
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1294
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGUGAGGUUGGCAUUGUUGUCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Cisplatin
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Regulation by the Disease Microenvironment (RTDM) | ||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Overexpression of miR-1294 ameliorated cisplatin-resistant OC malignancy via inhibiting IGF1R. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.