Molecule Information

General Information of the Molecule (ID: Mol01751)

• Name: hsa-miR-1291 ,Homo sapiens
• Synonyms: microRNA 1291
• Molecule Type: Mature miRNA
• Sequence: UGGCCCUGACUGAAGACCAGCAGU
• Ensembl ID: ENSG00000281842
• HGNC ID: HGNC:35284
• Mature Accession: MIMAT0005881

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic carcinoma [1]

• Sensitive Disease: Pancreatic carcinoma [ICD-11: 2C10.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Hsa-miR-1291-directed downregulation of ABCC1 led to a greater intracellular drug accumulation and sensitized the cells to doxorubicin.

Disease Class: Lung small cell carcinoma [1]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Hsa-miR-1291-directed downregulation of ABCC1 led to a greater intracellular drug accumulation and sensitized the cells to doxorubicin.

References

• Ref 1: Small nucleolar RNA-derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCC1. Drug Metab Dispos. 2013 Oct;41(10):1744-51. doi: 10.1124/dmd.113.052092. Epub 2013 May 16.