Molecule Information

General Information of the Molecule (ID: Mol01747)

• Name: hsa-miR-1183 ,Homo sapiens
• Synonyms: microRNA 1183
• Molecule Type: Mature miRNA
• Sequence: CACUGUAGGUGAUGGUGAGAGUGGGCA
• Ensembl ID: ENSG00000221783
• HGNC ID: HGNC:35264
• Mature Accession: MIMAT0005828

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR1183/PDPk1 signaling pathway; Activation; hsa05206
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR1183/PDPk1 signaling pathway; Activation; hsa05206
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells.

Icotinib hydrochloride

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Icotinib hydrochloride
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR1183/PDPk1 signaling pathway; Activation; hsa05206
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells.

References

• Ref 1: Circular RNA hsa_circ_0004015 regulates the proliferation, invasion, and TKI drug resistance of non-small cell lung cancer by miR-1183/PDPK1 signaling pathway. Biochem Biophys Res Commun. 2019 Jan 8;508(2):527-535. doi: 10.1016/j.bbrc.2018.11.157. Epub 2018 Nov 30.