Molecule Information

General Information of the Molecule (ID: Mol01746)

• Name: hsa-miR-1182 ,Homo sapiens
• Synonyms: microRNA 1182
• Molecule Type: Mature miRNA
• Sequence: GAGGGUCUUGGGAGGGAUGUGAC
• Ensembl ID: ENSG00000283799
• HGNC ID: HGNC:35263
• Mature Accession: MIMAT0005827

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [1]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BCa cells; Bladder; Homo sapiens (Human); N.A.
• In Vitro Model: Hcv29 cells; Bladder; Homo sapiens (Human); CVCL_8228
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-1182 was significantly downregulated in bladder cancer cells and tumor tissues. miR-1182 inhibited cell proliferation and invasion, induced apoptosis and cell cycle arrest, and mediated the chemosensitivity of bladder cancer cells to cisplatin by targeting hTERT.

References

• Ref 1: miR-1182 inhibits growth and mediates the chemosensitivity of bladder cancer by targeting hTERT. Biochem Biophys Res Commun. 2016 Feb 5;470(2):445-452. doi: 10.1016/j.bbrc.2016.01.014. Epub 2016 Jan 7.