Molecule Information

General Information of the Molecule (ID: Mol01745)

• Name: hsa-miR-320c ,Homo sapiens
• Synonyms: microRNA 320c-1
• Molecule Type: Mature miRNA
• Sequence: AAAAGCUGGGUUGAGAGGGU
• Ensembl ID: ENSG00000221493
• HGNC ID: HGNC:35248
• Mature Accession: MIMAT0005793

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [1]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PSN1 cells; Pancreas; Homo sapiens (Human); CVCL_1644
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-320c regulates the resistance of pancreatic cancer cells to gemcitabine through SMARCC1.

References

• Ref 1: miR-320c regulates gemcitabine-resistance in pancreatic cancer via SMARCC1. Br J Cancer. 2013 Jul 23;109(2):502-11. doi: 10.1038/bjc.2013.320. Epub 2013 Jun 25.