Molecule Information

General Information of the Molecule (ID: Mol01743)

• Name: hsa-miR-935 ,Homo sapiens
• Synonyms: microRNA 935
• Molecule Type: Mature miRNA
• Sequence: CCAGUUACCGCUUCCGCUACCGC
• Ensembl ID: ENSG00000284583
• HGNC ID: HGNC:33678
• Mature Accession: MIMAT0004978

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Knockdown of miR 935 increases paclitaxel sensitivity via regulation of SOX7 in non small cell lung cancer.

References

• Ref 1: Knockdown of miR 935 increases paclitaxel sensitivity via regulation of SOX7 in non small cell lung cancer. Mol Med Rep. 2018 Sep;18(3):3397-3402. doi: 10.3892/mmr.2018.9330. Epub 2018 Jul 27.