Molecule Information

General Information of the Molecule (ID: Mol01742)

• Name: hsa-miR-216b-5p ,Homo sapiens
• Synonyms: microRNA 216b
• Molecule Type: Mature miRNA
• Sequence: AAAUCUCUGCAGGCAAAUGUGA
• Ensembl ID: ENSG00000211520
• HGNC ID: HGNC:33668
• Mature Accession: MIMAT0004959

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [1]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Long non-coding RNA Linc00518 Can enhance GATA6 expression by suppressing miR-216b-5p expression to promotes paclitaxel resistance in the human prostate cancer.

References

• Ref 1: Long non-coding RNA Linc00518 promotes paclitaxel resistance of the human prostate cancer by sequestering miR-216b-5p. Biol Cell. 2019 Feb;111(2):39-50. doi: 10.1111/boc.201800054. Epub 2018 Dec 7.