Molecule Information

General Information of the Molecule (ID: Mol01740)

• Name: hsa-miR-760 ,Homo sapiens
• Synonyms: microRNA 760
• Molecule Type: Mature miRNA
• Sequence: CGGCUCUGGGUCUGUGGGGA
• Ensembl ID: ENSG00000211575
• HGNC ID: HGNC:33666
• Mature Accession: MIMAT0004957

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1], [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: TGF-beta/Wnt/G protein signaling pathway; Regulation; hsa04010
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). And miR-760 downregulation can enhance glioblastoma cells resistance to temozolomide through TGF-beta signaling pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [3]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Notch1/HES1-PTEN/AKT signaling pathway; Regulation; hsa04330
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Caspase-3 Activity kit assay
• Mechanism Description: miR-760 inhibits Dox-resistance in HCC cells through inhibiting Notch1 and promoting PTEN expression.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• In Vitro Model: MCF-7/DOX cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR760 mediates chemoresistance through inhibition of epithelial mesenchymal transition in breast cancer cells, overexpression of miR760 suppressed the expression of Nanog, a transcriptional factor involved in chemoresistance, and resulted in the reversal of EMT in breast cancer cells.

References

• Ref 1: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 2: Systematic analysis of gene expression pattern in has-miR-760 overexpressed resistance of the MCF-7 human breast cancer cell to doxorubicin. Biomed Pharmacother. 2015 Feb;69:162-9. doi: 10.1016/j.biopha.2014.11.028. Epub 2014 Nov 25.
• Ref 3: MicroRNA-760 Inhibits Doxorubicin Resistance in Hepatocellular Carcinoma through Regulating Notch1/Hes1-PTEN/Akt Signaling Pathway. J Biochem Mol Toxicol. 2018 Aug;32(8):e22167. doi: 10.1002/jbt.22167. Epub 2018 Jul 3.
• Ref 4: miR-760 mediates chemoresistance through inhibition of epithelial mesenchymal transition in breast cancer cells. Eur Rev Med Pharmacol Sci. 2016 Dec;20(23):5002-5008.