Molecule Information

General Information of the Molecule (ID: Mol01739)

• Name: hsa-miR-543 ,Homo sapiens
• Synonyms: microRNA 543
• Molecule Type: Mature miRNA
• Sequence: AAACAUUCGCGGUGCACUUCUU
• Ensembl ID: ENSG00000212040
• HGNC ID: HGNC:33664
• Mature Accession: MIMAT0004954

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: PTEN/PI3K/AKT signaling pathway; Activation; hsa05235
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell assay; Flow cytometry assay
• Mechanism Description: miR-543 enhanced drug resistance by down-regulating the expression of phosphatase and tensin homolog (PTEN), which negatively regulates protein kinase B (AkT) activation while an elevated expression of PTEN reversed the chemoresistance of miR-543-overexpressing HCT8 cells to 5-FU.

References

• Ref 1: Down-regulation of miR-543 expression increases the sensitivity of colorectal cancer cells to 5-Fluorouracil through the PTEN/PI3K/AKT pathway. Biosci Rep. 2019 Mar 22;39(3):BSR20190249. doi: 10.1042/BSR20190249. Print 2019 Mar 29.