Molecule Information

General Information of the Molecule (ID: Mol01735)

• Name: hsa-miR-874-3p ,Homo sapiens
• Synonyms: microRNA 874
• Molecule Type: Mature miRNA
• Sequence: CUGCCCUGGCCCGAGGGACCGA
• Ensembl ID: ENSG00000216009
• HGNC ID: HGNC:33643
• Mature Accession: MIMAT0004911

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Hippo signaling pathway; Activation; hsa04391
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Caspase-9 or 3 activity assays; Flow cytometric analysis
• Mechanism Description: Down-regulation of miR874-3p promotes chemotherapeutic resistance in colorectal cancer via inactivation of the Hippo signaling pathway. miR874-3p directly inhibited the expression of transcriptional co-activators YAP and TAZ of the Hippo signaling pathway, resulting in the inactivation of the TEAD transcription.

References

• Ref 1: Downregulation of miR-874-3p promotes chemotherapeutic resistance in colorectal cancer via inactivation of the Hippo signaling pathway. Oncol Rep. 2017 Dec;38(6):3376-3386. doi: 10.3892/or.2017.6041. Epub 2017 Oct 17.