Molecule Information

General Information of the Molecule (ID: Mol01731)

• Name: hsa-miR-628-5p ,Homo sapiens
• Synonyms: microRNA 628
• Molecule Type: Mature miRNA
• Sequence: AUGCUGACAUAUUUACUAGAGG
• Ensembl ID: ENSG00000283891
• HGNC ID: HGNC:32884
• Mature Accession: MIMAT0004809

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [1]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: Caki-2 cells; Kidney; Homo sapiens (Human); CVCL_0235
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: High expression of miR-942, miR-628-5p, miR-133a, and miR-484 was significantly associated with decreased time to progression and overall survival. These microRNAs were also overexpressed in the sunitinib resistant cell line Caki-2 in comparison with the sensitive cell line.

References

• Ref 1: Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263. doi: 10.1371/journal.pone.0086263. eCollection 2014.