Molecule Information
General Information of the Molecule (ID: Mol01730)
Name |
hsa-miR-625-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 625
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GACUAUAGAACUUUCCCCCUCA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Oxaliplatin
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Colorectal adenocarcinoma | [1] | |||
Resistant Disease | Colorectal adenocarcinoma [ICD-11: 2B91.2] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
p38/MAPK signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | HEK293 Flp pFRT/eGFP cells | Kidney | Homo sapiens (Human) | CVCL_U427 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Inactivation of MAP2k6-p38 signalling as one likely mechanism of oxaliplatin resistance, and miR-625-3p induces oxaliplatin resistance by abrogating MAP2k6-p38-regulated apoptosis and cell cycle control networks. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.