Molecule Information

General Information of the Molecule (ID: Mol01729)

• Name: hsa-miR-589-5p ,Homo sapiens
• Synonyms: microRNA 589
• Molecule Type: Mature miRNA
• Sequence: UGAGAACCACGUCUGCUCUGAG
• Ensembl ID: ENSG00000207973
• HGNC ID: HGNC:32845
• Mature Accession: MIMAT0004799

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: STAT3 signaling pathway; Activation; hsa04550
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: QGY-7703 cells; Liver; Homo sapiens (Human); CVCL_6715
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: 97H cells; Liver; Homo sapiens (Human); N.A.
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometric analysis; Spheroid formation assay
• Mechanism Description: miR589-5p promotes the cancer stem cell characteristics and chemoresistance via targeting multiple negative regulators of STAT3 signaling pathway, including SOCS2, SOCS5, PTPN1 and PTPN11, leading to constitutive activation of STAT3 signaling.

References

• Ref 1: Maintenance of stemness by miR-589-5p in hepatocellular carcinoma cells promotes chemoresistance via STAT3 signaling. Cancer Lett. 2018 Jun 1;423:113-126. doi: 10.1016/j.canlet.2017.11.031. Epub 2017 Nov 28.