Molecule Information

General Information of the Molecule (ID: Mol01726)

• Name: hsa-miR-509-5p ,Homo sapiens
• Synonyms: microRNA 509-1
• Molecule Type: Mature miRNA
• Sequence: UACUGCAGACAGUGGCAAUCA
• Ensembl ID: ENSG00000208000
• HGNC ID: HGNC:32146
• Mature Accession: MIMAT0004779

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [1]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• Cell Pathway Regulation: TGF-beta signaling pathway; Inhibition; hsa04350
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: Su.86.86 cells; Pancreas; Homo sapiens (Human); CVCL_3881
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: KMP3 cells; Pancreas; Homo sapiens (Human); CVCL_8491
• In Vitro Model: KP4-4 cells; Pancreas; Homo sapiens (Human); CVCL_Y142
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-8 assay; Crystal violet staining assay
• Mechanism Description: miR509-5p and miR1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer miR509-5p induced an MET phenotype by directly regulating VIM and HMGA2.

References

• Ref 1: miR-509-5p and miR-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer. Sci Rep. 2017 Jun 21;7(1):4002. doi: 10.1038/s41598-017-04191-w.