Molecule Information

General Information of the Molecule (ID: Mol01725)

• Name: hsa-miR-508-5p ,Homo sapiens
• Synonyms: microRNA 508
• Molecule Type: Mature miRNA
• Sequence: UACUCCAGAGGGCGUCACUCAUG
• Ensembl ID: ENSG00000207589
• HGNC ID: HGNC:32145
• Mature Accession: MIMAT0004778

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.

References

• Ref 1: miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76. doi: 10.1038/onc.2013.297. Epub 2013 Jul 29.