Molecule Information

General Information of the Molecule (ID: Mol01723)

• Name: hsa-miR-501-3p ,Homo sapiens
• Synonyms: microRNA 501
• Molecule Type: Mature miRNA
• Sequence: AAUGCACCCGGGCAAGGAUUCU
• Ensembl ID: ENSG00000211538
• HGNC ID: HGNC:32135
• Mature Accession: MIMAT0004774

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [1]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-501-3p sensitizes glioma cells to cisplatin via reducing protein levels of MYCN.

References

• Ref 1: miR 501 3p sensitizes glioma cells to cisplatin by targeting MYCN. Mol Med Rep. 2018 Nov;18(5):4747-4752. doi: 10.3892/mmr.2018.9458. Epub 2018 Sep 5.