Molecule Information

General Information of the Molecule (ID: Mol01717)

• Name: hsa-miR-335-3p ,Homo sapiens
• Synonyms: microRNA 335
• Molecule Type: Mature miRNA
• Sequence: UUUUUCAUUAUUGCUCCUGACC
• Ensembl ID: ENSG00000199043
• HGNC ID: HGNC:31773
• Mature Accession: MIMAT0004703

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ER-alpha signaling pathway; Inhibition; hsa04915
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Crystal Violet Assay
• Mechanism Description: microRNA-335-5p and -3p synergize to inhibit estrogen receptor alpha expression and promote tamoxifen resistance. MiRNA duplex repressed genes involved in the ERalpha signaling pathway, and enhanced resistance of MCF-7 cells to the growth inhibitory effects of tamoxifen.

References

• Ref 1: MicroRNA-335-5p and -3p synergize to inhibit estrogen receptor alpha expression and promote tamoxifen resistance. FEBS Lett. 2017 Jan;591(2):382-392. doi: 10.1002/1873-3468.12538. Epub 2017 Jan 12.