Molecule Information

General Information of the Molecule (ID: Mol01715)
Name
hsa-miR-340-5p ,Homo sapiens
Synonyms
microRNA 340
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUAUAAAGCAAUGAGACUGAUU
    Click to Show/Hide
Ensembl ID
ENSG00000198995
HGNC ID
HGNC:31777
Mature Accession
MIMAT0004692
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT/mTOR signaling pathway Activation hsa04151
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description OIP5-AS1 regulates cisplatin resistance by activating the PI3k/AkT/mTOR signaling pathway.
Disease Class: Hepatocellular carcinoma [2]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
NRAL/miR340-5p/Nrf2 signaling pathway Regulation hsa05206
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description There is mutual inhibition between NRAL and mir-340-5p and NRAL directly interacts with miR-340-5p to up-regulate the expression of its target, Nrf2, to mediate cisplatin-resistant HCC phenotypes.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [3]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
MG63/CDDP cells Bone Homo sapiens (Human) CVCL_0426
SAOS-2/CDDP cells Bone Homo sapiens (Human) CVCL_0548
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Annexin V-FITC apoptosis assay
Mechanism Description microRNA-340-5p modulates cisplatin resistance by targeting LPAATbeta in osteosarcoma.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
BT549 cells Breast Homo sapiens (Human) CVCL_1092
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description Overexpressed miR-340-5p inhibited cell proliferation and drug resistance with increased apoptosis of breast cancer cells through down-regulating LGR5 expression via Wnt/beta-catenin pathway.
References
Ref 1 Long noncoding RNA OIP5-AS1 causes cisplatin resistance in osteosarcoma through inducing the LPAATBeta/PI3K/AKT/mTOR signaling pathway by sponging the miR-340-5p. J Cell Biochem. 2019 Jun;120(6):9656-9666. doi: 10.1002/jcb.28244. Epub 2018 Dec 11.
Ref 2 NRAL mediates cisplatin resistance in hepatocellular carcinoma via miR-340-5p/Nrf2 axis. J Cell Commun Signal. 2019 Mar;13(1):99-112. doi: 10.1007/s12079-018-0479-x. Epub 2018 Jul 20.
Ref 3 MicroRNA-340-5p modulates cisplatin resistance by targeting LPAATBeta in osteosarcoma. Braz J Med Biol Res. 2017 Apr 20;50(5):e6359. doi: 10.1590/1414-431X20176359.
Ref 4 LGR5 acts as a target of miR-340-5p in the suppression of cell progression and drug resistance in breast cancer via Wnt/Beta-catenin pathway. Gene. 2019 Jan 30;683:47-53. doi: 10.1016/j.gene.2018.10.014. Epub 2018 Oct 6.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.