Molecule Information

General Information of the Molecule (ID: Mol01710)

• Name: hsa-miR-188-3p ,Homo sapiens
• Synonyms: microRNA 188
• Molecule Type: Mature miRNA
• Sequence: CUCCCACAUGCAGGGUUUGCA
• Ensembl ID: ENSG00000207768
• HGNC ID: HGNC:31559
• Mature Accession: MIMAT0004613

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [1]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-1 cells; Pancreas; Homo sapiens (Human); CVCL_0237
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Soft agar assay
• Mechanism Description: Long non-coding RNA LINC00346 promotes pancreatic cancer growth and gemcitabine resistance by sponging miR-188-3p to derepress BRD4 expression.

References

• Ref 1: Long non-coding RNA LINC00346 promotes pancreatic cancer growth and gemcitabine resistance by sponging miR-188-3p to derepress BRD4 expression. J Exp Clin Cancer Res. 2019 Feb 6;38(1):60. doi: 10.1186/s13046-019-1055-9.