Molecule Information

General Information of the Molecule (ID: Mol01708)

Name	hsa-miR-130a-5p ,Homo sapiens
Synonyms	microRNA 130a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	GCUCUUUUCACAUUGUGCUACU Click to Show/Hide
Ensembl ID	ENSG00000208009
HGNC ID	HGNC:31514
Mature Accession	MIMAT0004593
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Tamoxifen

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Resistant Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Resistant Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	Downregulated LncRNA ADAMTS9-AS2 in breast cancer enhances tamoxifen resistance by activating microRNA-130a-5p.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	Low expression of ADAMTS9-AS2 inhibits PTEN expression and enhances tamoxifen resistance through targeting microRNA-130a-5p.

References

Ref 1	Downregulated lncRNA ADAMTS9-AS2 in breast cancer enhances tamoxifen resistance by activating microRNA-130a-5p. Eur Rev Med Pharmacol Sci. 2019 Feb;23(4):1563-1573. doi: 10.26355/eurrev_201902_17115.