Molecule Information

General Information of the Molecule (ID: Mol01702)

Name	hsa-miR-297 ,Homo sapiens
Synonyms	microRNA 297 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	AUGUAUGUGUGCAUGUGCAUG Click to Show/Hide
Ensembl ID	ENSG00000215961
HGNC ID	HGNC:33691
Mature Accession	MIMAT0004450
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Oxaliplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal carcinoma				[1]
Sensitive Disease	Colorectal carcinoma [ICD-11: 2B91.3]			Disease Info
Sensitive Drug	Oxaliplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-8 cells	Colon	Homo sapiens (Human)	CVCL_2478
Experiment for Molecule Alteration	RT-PCR; qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo.

Vincristine

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal carcinoma				[1]
Sensitive Disease	Colorectal carcinoma [ICD-11: 2B91.3]			Disease Info
Sensitive Drug	Vincristine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-8 cells	Colon	Homo sapiens (Human)	CVCL_2478
Experiment for Molecule Alteration	RT-PCR; qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo.

References

Ref 1	miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2. Biochem J. 2012 Sep 1;446(2):291-300. doi: 10.1042/BJ20120386.