Molecule Information

General Information of the Molecule (ID: Mol01700)

Name	hsa-miR-770-5p ,Homo sapiens
Synonyms	microRNA 770 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UCCAGUACCACGUGUCAGGGCCA Click to Show/Hide
Ensembl ID	ENSG00000211574
HGNC ID	HGNC:33143
Mature Accession	MIMAT0003948
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer				[1]
Resistant Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
In Vitro Model	A2780CP cells	Ovary	Homo sapiens (Human)	CVCL_0135
	C13 cells	Ovary	Homo sapiens (Human)	CVCL_0114
Experiment for Molecule Alteration	qRT-PCR; ISH
Experiment for Drug Resistance	Flow cytometry assay; TUNEL assay
Mechanism Description	miR-770-5p inhibits cisplatin chemoresistance in human ovarian cancer by targeting and reducing the level of ERCC2.

Trastuzumab

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: HER2 positive breast cancer				[2]
Sensitive Disease	HER2 positive breast cancer [ICD-11: 2C60.8]			Disease Info
Sensitive Drug	Trastuzumab			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell invasion		Inhibition	hsa05200
	Cell proliferation		Inhibition	hsa05200
	HER2 signaling pathway		Activation	hsa04012
In Vitro Model	SkBR3 cells	Breast	Homo sapiens (Human)	CVCL_0033
	BT474 cells	Breast	Homo sapiens (Human)	CVCL_0179
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	WST1 assay
Mechanism Description	miR-770-5p overexpression downregulated HER2 and increased the effect of trastuzumab.

References

Ref 1	MiR-770-5p inhibits cisplatin chemoresistance in human ovarian cancer by targeting ERCC2. Oncotarget. 2016 Aug 16;7(33):53254-53268. doi: 10.18632/oncotarget.10736.
Ref 2	Involvement of miR-770-5p in trastuzumab response in HER2 positive breast cancer cells. PLoS One. 2019 Apr 22;14(4):e0215894. doi: 10.1371/journal.pone.0215894. eCollection 2019.